Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Cytogenetics of three breeds of river buffalo (Bubalus bubalis L.), with evidence of a fragile site on the X chromosome

The cytogenetic study of 182 river buffalo (Bubalus bubalis L., 2n=50) of Murrah, Mediterranean and Jaffarabadi breeds, from the State of São Paulo, was carried out to characterize their chromosomes and to detect possible chromosomal abnormalities. The karyotypes were indistinguishable with conventional staining as well as with C and replication R banding techniques. In about 44% of the sample (8 males and 72 females), an X marker chromosome due to a fragile site was shown. The frequency of metaphases expressing the fragility site on the X was highly variable, from 2.86 to 41.03%. In females, the fragile site, rarely appeared on both X chromosomes. Most of the metaphases showed only 1 marker chromosome. In R-banded metaphases using 5-bromodeoxyuridine (BrdU) treatment, it corresponded in general to the late replicating X chromosome. No correlation between the X fragile site and altered phenotype was found. Structural and numerical chromosome rearrangements were ruled out in the present sample of buffalo. (C) 1998 by Elsevier B.V.

Les sites fragiles autosomiques. [[Autosomal fragile sites].

It is possible to distribute the 17 autosomic fragile sites presently known in three categories according to their sensitivity: BrdU-sensitive sites (10q25, 16q22, 17p12), distamycin A-sensitive sites (16q22, 17p12) and folate- and thymidilate-sensitive sites (2q11-q14, 3p14, 6p23, 7p11, 8q22, 9p21, 9q32, 10q23, 11q13, 11q23, 12q13, 16p12, 16q23, 17p12, 20p11). Four fundamental problems are discussed, first the relation between the presence of a fragile site and the phenotype, secondly the incidence of autosomic sites, third the origin of fragility (particularity of DNA structure, defect of the DNA/proteins binding and abnormal arrangement of chromatin, abnormality of the metaphasic scaffold) and fourth the localization of fragile sites.

IDENTIFICATION OF COMMON FRAGILE SITES IN CHROMOSOMES OF 2 SPECIES OF BAT (CHIROPTERA, MAMMALIA)

In the karyotypes of the bat species Molossus ater and M molossus, spontaneous and bromodeoxyuridine (BrdU)- or aphidicolin (APC)-sensitive fragile sites were located. Four chromosome regions harbored APC-sensitive fragile sites: 1q9 and 8q4 in both M ater and M molossus, 3q3 in M ater, and 1p7 in M molossus. The fragile sites in 1q9 and 8q4 were also observed without induction in M molossus. BrdU-sensitive fragile sites were not detected. Despite observations in several other species, the fragile sites detected in Molossus are not coincident with the breakpoints involved in the chromosome rearrangements occurring in the evolution of 7 species of the Molossidae family.

Experience with molecular and cytogenetic diagnosis of fragile X syndrome in Brazilian families

We report on the cytogenetic and DNA analysis of 55 families with the fragile X (FMR-1 locus) mutation (318 individuals and 15 chorionic villi samples). A total of 129 males were investigated, 54 mentally normal and 75 presenting mental retardation. Among the 54 normal males, 11 had the premutation, and none expressed the fragile site. The full mutation was detected in 73 retarded males, and 14 (18%) presented a premutation along with the full mutation (mosaics). All of them manifested the fragile site. The frequencies of fragile site expression correlated positively with the sizes of the expansion of the CGG repeats (D). Among 153 normal females, 85 were found to be heterozygous for the premutation and 15 had the full mutation. In the premutated females the fragile site was not observed or it occurred at frequencies that did not differ from those observed in 53 noncarriers. Cytogenetic analysis was thus ineffective for the diagnosis of premutated males or females. Among the 51 heterozygotes for the full mutation, 36 (70%) had some degree of mental impairment. As in males, a positive correlation was detected between the frequencies of fragile site manifestation and the size of the expansion. However, the cytogenetic test was less effective for the detection of fully mutated females, than in the case of males, since 14% false negative results were found among females. Segregation analysis confirmed that the risk of mental retardation in the offspring of heterozygotes increases with the length of D. The average observed frequency of mental retardation in the offspring of all heterozygotes was 30%. There was no indication of meiotic drive occurring in female carriers, since the number of individuals who inherited the mutation did not differ from the number of those inheriting the normal allele. No new mutations were detected in the 55 genealogies studied here.

Sequence of the FRA3B common fragile region: Implications for the mechanism of FHIT deletion

The hypothesis that chromosomal fragile sites may be “weak links” that result in hot spots for cancer-specific chromosome rearrangements was supported by the discovery that numerous cancer cell homozygous deletions and a familial translocation map within the FHIT gene, which encompasses the common fragile site, FRA3B. Sequence analysis of 276 kb of the FRA3B/FHIT locus and 22 associated cancer cell deletion endpoints shows that this locus is a frequent target of homologous recombination between long interspersed nuclear element sequences resulting in FHIT gene internal deletions, probably as a result of carcinogen-induced damage at FRA3B fragile sites.

Simple tandem DNA repeats and human genetic disease.

The human genome contains many repeated DNA sequences that vary in complexity of repeating unit from a single nucleotide to a whole gene. The repeat sequences can be widely dispersed or in simple tandem arrays. Arrays of up to 5 or 6 nt are known as simple tandem repeats, and these are widely dispersed and highly polymorphic. Members of one group of the simple tandem repeats, the trinucleotide repeats, can undergo an increase in copy number by a process of dynamic mutation. Dynamic mutations of the CCG trinucleotide give rise to one group of fragile sites on human chromosomes, the rare folate-sensitive group. One member of this group, the fragile X (FRAXA) is responsible for the most common familial form of mental retardation. Another member of the group FRAXE is responsible for a rarer mild form of mental retardation. Similar mutations of AGC repeats give rise to a number of neurological disorders. The expanded repeats are unstable between generations and somatically. The intergenerational instability gives rise to unusual patterns of inheritance--particularly anticipation, the increasing severity and/or earlier age of onset of the disorder in successive generations. Dynamic mutations have been found only in the human species, and possible reasons for this are considered. The mechanism of dynamic mutation is discussed, and a number of observations of simple tandem repeat mutation that could assist in understanding this phenomenon are commented on.

Genetic heterogeneity in familial acute myelogenous leukemia: Evidence for a second locus at chromosome 16q21-23.2

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

Woodland Improvement and Crop Trees in Iowa, 2005

Vigorous and Healthy woodlands in Iowa have the unique distinction of being able to provide a wealth of benefits for the landowner and residents of the state. Benefits from a healthy forest include timber and wood resources, watershed protection, fragile site protection, wildlife and bird habitat, aesthetics and beauty, and recreational opportunities.