A limited area model intercomparison on the "Montserrat-2000" flash-flood event using statistical and deterministic methods

In the scope of the European project Hydroptimet, INTERREG IIIB-MEDOCC programme, limited area model (LAM) intercomparison of intense events that produced many damages to people and territory is performed. As the comparison is limited to single case studies, the work is not meant to provide a measure of the different models' skill, but to identify the key model factors useful to give a good forecast on such a kind of meteorological phenomena. This work focuses on the Spanish flash-flood event, also known as "Montserrat-2000" event. The study is performed using forecast data from seven operational LAMs, placed at partners' disposal via the Hydroptimet ftp site, and observed data from Catalonia rain gauge network. To improve the event analysis, satellite rainfall estimates have been also considered. For statistical evaluation of quantitative precipitation forecasts (QPFs), several non-parametric skill scores based on contingency tables have been used. Furthermore, for each model run it has been possible to identify Catalonia regions affected by misses and false alarms using contingency table elements. Moreover, the standard "eyeball" analysis of forecast and observed precipitation fields has been supported by the use of a state-of-the-art diagnostic method, the contiguous rain area (CRA) analysis. This method allows to quantify the spatial shift forecast error and to identify the error sources that affected each model forecasts. High-resolution modelling and domain size seem to have a key role for providing a skillful forecast. Further work is needed to support this statement, including verification using a wider observational data set.

Estimation of the extreme flash flood evolution in Barcelona county from 1351 to 2005

Every year, flash floods cause economic losses and major problems for undertaking daily activity in the Catalonia region (NE Spain). Sometimes catastrophic damage and casualties occur. When a long term analysis of floods is undertaken, a question arises regarding the changing role of the vulnerability and the hazard in risk evolution. This paper sets out to give some information to deal with this question, on the basis of analysis of all the floods that have occurred in Barcelona county (Catalonia) since the 14th century, as well as the flooded area, urban evolution, impacts and the weather conditions for any of most severe events. With this objective, the identification and classification of historical floods, and characterisation of flash-floods among these, have been undertaken. Besides this, the main meteorological factors associated with recent flash floods in this city and neighbouring regions are well-known. On the other hand, the identification of rainfall trends that could explain the historical evolution of flood hazard occurrence in this city has been analysed. Finally, identification of the influence of urban development on the vulnerability to floods has been carried out. Barcelona city has been selected thanks to its long continuous data series (daily rainfall data series, since 1854; one of the longest rainfall rate series of Europe, since 1921) and for the accurate historical archive information that is available (since the Roman Empire for the urban evolution). The evolution of flood occurrence shows the existence of oscillations in the earlier and later modern-age periods that can be attributed to climatic variability, evolution of the perception threshold and changes in vulnerability. A great increase of vulnerability can be assumed for the period 1850¿1900. The analysis of the time evolution for the Barcelona rainfall series (1854¿2000) shows that no trend exists, although, due to changes in urban planning, flash-floods impact has altered over this time. The number of catastrophic flash floods has diminished, although the extraordinary ones have increased.

Flash flood evolution in North-Western Mediterranean

The present paper shows an in-depth analysis of the evolution of floods and precipitation in Catalonia for the period 1981-2010. In order to have homogeneous information, and having in mind that not gauge data was available for all the events, neither for all the rivers and stream flows, daily press from a specific newspaper has been systematically analysed for this period. Furthermore a comparison with a longer period starting in 1900 has been done. 219 flood events (mainly flash flood events) have been identified for the period of 30 years (375 starting in 1900), 79 of them were ordinary, 117 of them were extraordinary and 23 of them were catastrophic, being autumn and summer the seasons with the maxima values. 19% of the events caused a total of 110 casualties. 60% of them died when they tried to cross the street or the stream. Factors like the evolution of precipitation, population density and other socio-economical aspects have been considered. The trend analysis shows an increase of 1 flood/decade that probably has been mainly due to inter-annual and intra-annual changes in population density and in land-use and land-cover.

Integration of remote sensing and GIS for modelling flash floods in Wadi Hudain catchment, Egypt

This paper presents a new approach to modelling flash floods in dryland catchments by integrating remote sensing and digital elevation model (DEM) data in a geographical information system (GIS). The spectral reflectance of channels affected by recent flash floods exhibit a marked increase, due to the deposition of fine sediments in these channels as the flood recedes. This allows the parts of a catchment that have been affected by a recent flood event to be discriminated from unaffected parts, using a time series of Landsat images. Using images of the Wadi Hudain catchment in southern Egypt, the hillslope areas contributing flow were inferred for different flood events. The SRTM3 DEM was used to derive flow direction, flow length, active channel cross-sectional areas and slope. The Manning Equation was used to estimate the channel flow velocities, and hence the time-area zones of the catchment. A channel reach that was active during a 1985 runoff event, that does not receive any tributary flow, was used to estimate a transmission loss rate of 7·5 mm h−1, given the maximum peak discharge estimate. Runoff patterns resulting from different flood events are quite variable; however the southern part of the catchment appears to have experienced more floods during the period of study (1984–2000), perhaps because the bedrock hillslopes in this area are more effective at runoff production than other parts of the catchment which are underlain by unconsolidated Quaternary sands and gravels. Due to high transmission loss, runoff generated within the upper reaches is rarely delivered to the alluvial fan and Shalateen city situated at the catchment outlet. The synthetic GIS-based time area zones, on their own, cannot be relied on to model the hydrographs reliably; physical parameters, such as rainfall intensity, distribution, and transmission loss, must also be considered.

The catastrophic flash-flood event of 8–9 September 2002 in the Gard region, France: a first case study for the Cévennes–Vivarais Mediterranean Hydrometeorological Observatory

The Cévennes–Vivarais Mediterranean Hydrometeorological Observatory (OHM-CV) is a research initiative aimed at improving the understanding and modeling of the Mediterranean intense rain events that frequently result in devastating flash floods in southern France. A primary objective is to bring together the skills of meteorologists and hydrologists, modelers and instrumentalists, researchers and practitioners, to cope with these rather unpredictable events. In line with previously published flash-flood monographs, the present paper aims at documenting the 8–9 September 2002 catastrophic event, which resulted in 24 casualties and an economic damage evaluated at 1.2 billion euros (i.e., about 1 billion U.S. dollars) in the Gard region, France. A description of the synoptic meteorological situation is first given and shows that no particular precursor indicated the imminence of such an extreme event. Then, radar and rain gauge analyses are used to assess the magnitude of the rain event, which was particularly remarkable for its spatial extent with rain amounts greater than 200 mm in 24 h over 5500 km2. The maximum values of 600–700 mm observed locally are among the highest daily records in the region. The preliminary results of the postevent hydrological investigation show that the hydrologic response of the upstream watersheds of the Gard and Vidourle Rivers is consistent with the marked space–time structure of the rain event. It is noteworthy that peak specific discharges were very high over most of the affected areas (5–10 m3 s−1 km−2) and reached locally extraordinary values of more than 20 m3 s−1 km−2. A preliminary analysis indicates contrasting hydrological behaviors that seem to be related to geomorphological factors, notably the influence of karst in part of the region. An overview of the ongoing meteorological and hydrological research projects devoted to this case study within the OHM-CV is finally presented.

Effects of high-energy astrophysical events on habitable planets

With the possible exception of meteor impacts, high-energy astrophysical events such as supernovae, gamma-ray bursts (GRB) and flares are usually not taken into account for biological and evolutionary studies due to their low rates of occurrence. We show that a class of these events may occur at distances and time scales in which their biological effects are non-negligible, maybe more frequent than the impacts of large asteroids. We review the effects of four transient astrophysical sources of ionizing radiation on biospheres - stellar flares, giant flares from soft gamma repeaters (SGR), supernovae and GRB. The main damaging features of them are briefly discussed and illustrated. We point out some open problems and ongoing work. Received 28 February 2012, accepted 6 July 2012, first published online 10 August 2012

Flash floods and their effects on the development in El-Qaá plain area in South Sinai, Egypt

The arid regions are dominated to a much larger degree than humid regions by major catastrophic events. Although most of Egypt lies within the great hot desert belt; it experiences especially in the north some torrential rainfall, which causes flash floods all over Sinai Peninsula. Flash floods in hot deserts are characterized by high velocity and low duration with a sharp discharge peak. Large sediment loads may be carried by floods threatening fields and settlements in the wadis and even people who are living there. The extreme spottiness of rare heavy rainfall, well known to desert people everywhere, precludes any efficient forecasting. Thus, although the limitation of data still reflects pre-satellite methods, chances of developing a warning system for floods in the desert seem remote. The relatively short flood-to-peak interval, a characteristic of desert floods, presents an additional impediment to the efficient use of warning systems. The present thesis contains introduction and five chapters, chapter one points out the physical settings of the study area. There are the geological settings such as outcrop lithology of the study area and the deposits. The alluvial deposits of Wadi Moreikh had been analyzed using OSL dating to know deposits and palaeoclimatic conditions. The chapter points out as well the stratigraphy and the structure geology containing main faults and folds. In addition, it manifests the pesent climate conditions such as temperature, humidity, wind and evaporation. Besides, it presents type of soils and natural vegetation cover of the study area using unsupervised classification for ETM+ images. Chapter two points out the morphometric analysis of the main basins and their drainage network in the study area. It is divided into three parts: The first part manifests the morphometric analysis of the drainage networks which had been extracted from two main sources, topographic maps and DEM images. Basins and drainage networks are considered as major influencing factors on the flash floods; Most of elements were studied which affect the network such as stream order, bifurcation ratio, stream lengths, stream frequency, drainage density, and drainage patterns. The second part of this chapter shows the morphometric analysis of basins such as area, dimensions, shape and surface. Whereas, the third part points the morphometric analysis of alluvial fans which form most of El-Qaá plain. Chapter three manifests the surface runoff through rainfall and losses analysis. The main subject in this chapter is rainfall which has been studied in detail; it is the main reason for runoff. Therefore, all rainfall characteristics are regarded here such as rainfall types, distribution, rainfall intensity, duration, frequency, and the relationship between rainfall and runoff. While the second part of this chapter concerns with water losses estimation by evaporation and infiltration which are together the main losses with direct effect on the high of runoff. Finally, chapter three points out the factors influencing desert runoff and runoff generation mechanism. Chapter four is concerned with assessment of flood hazard, it is important to estimate runoff and tocreate a map of affected areas. Therefore, the chapter consists of four main parts; first part manifests the runoff estimation, the different methods to estimate runoff and its variables such as runoff coefficient lag time, time of concentration, runoff volume, and frequency analysis of flash flood. While the second part points out the extreme event analysis. The third part shows the map of affected areas for every basin and the flash floods degrees. In this point, it has been depending on the DEM to extract the drainage networks and to determine the main streams which are normally more dangerous than others. Finally, part four presets the risk zone map of total study area which is of high inerest for planning activities. Chapter five as the last chapter concerns with flash flood Hazard mitigation. It consists of three main parts. First flood prediction and the method which can be used to predict and forecast the flood. The second part aims to determine the best methods which can be helpful to mitigate flood hazard in the arid zone and especially the study area. Whereas, the third part points out the development perspective for the study area indicating the suitable places in El-Qaá plain for using in economic activities.

Characterisation of flash floods in small ungauged mountain basins of Central Spain using an integrated approach

One of the main problems of flood hazard assessment in ungauged or poorly gauged basins is the lack of runoff data. In an attempt to overcome this problem we have combined archival records, dendrogeomorphic time series and instrumental data (daily rainfall and discharge) from four ungauged and poorly gauged mountain basins in Central Spain with the aim of reconstructing and compiling information on 41 flash flood events since the end of the 19th century. Estimation of historical discharge and the incorporation of uncertainty for the at-site and regional flood frequency analysis were performed with an empirical rainfall–runoff assessment as well as stochastic and Bayesian Markov Chain Monte Carlo (MCMC) approaches. Results for each of the ungauged basins include flood frequency, severity, seasonality and triggers (synoptic meteorological situations). The reconstructed data series clearly demonstrates how uncertainty can be reduced by including historical information, but also points to the considerable influence of different approaches on quantile estimation. This uncertainty should be taken into account when these data are used for flood risk management.

Unravelling past flash flood activity in a forested mountain catchment of the Spanish Central System

Flash floods represent one of the most common natural hazards in mountain catchments, and are frequent in Mediterranean environments. As a result of the widespread lack of reliable data on past events, the understanding of their spatio-temporal occurrence and their climatic triggers remains rather limited. Here, we present a dendrogeomorphic reconstruction of past flash flood activity in the Arroyo de los Puentes stream (Sierra de Guadarrama, Spanish Central System). We analyze a total of 287 increment cores from 178 disturbed Scots pine trees (Pinus sylvestris L.) which yielded indications on 212 growth disturbances related to past flash flood impact. In combination with local archives, meteorological data, annual forest management records and highly-resolved terrestrial data (i.e., LiDAR data and aerial imagery), the dendrogeomorphic time series allowed dating 25 flash floods over the last three centuries, with a major event leaving an intense geomorphic footprint throughout the catchment in 1936. The analysis of meteorological records suggests that the rainfall thresholds of flash floods vary with the seasonality of events. Dated flash floods in the 20th century were primarily related with synoptic troughs owing to the arrival of air masses from north and west on the Iberian Peninsula during negative indices of the North Atlantic Oscillation. The results of this study contribute considerably to a better understanding of hazards related with hydrogeomorphic processes in central Spain in general and in the Sierra de Guadarrama National Park in particular.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Engagement of multifocal neural circuits during recall of autobiographical happy events

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

High-energy events and short-term changes in superficial beach sediments

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Surveillance for adverse events after DTwP/Hib vaccination in Brazil: sensitivity and factors associated with reporting

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use