Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Ankhd1 Silencing Inhibits Stathmin 1 Activity, Cell Proliferation And Migration Of Leukemia Cells.

ANKHD1 is highly expressed in human acute leukemia cells and potentially regulates multiple cellular functions through its ankyrin-repeat domains. In order to identify interaction partners of the ANKHD1 protein and its role in leukemia cells, we performed a yeast two-hybrid system screen and identified SIVA, a cellular protein known to be involved in proapoptotic signaling pathways. The interaction between ANKHD1 and SIVA was confirmed by co-imunoprecipitation assays. Using human leukemia cell models and lentivirus-mediated shRNA approaches, we showed that ANKHD1 and SIVA proteins have opposing effects. While it is known that SIVA silencing promotes Stathmin 1 activation, increased cell migration and xenograft tumor growth, we showed that ANKHD1 silencing leads to Stathmin 1 inactivation, reduced cell migration and xenograft tumor growth, likely through the inhibition of SIVA/Stathmin 1 association. In addition, we observed that ANKHD1 knockdown decreases cell proliferation, without modulating apoptosis of leukemia cells, while SIVA has a proapoptotic function in U937 cells, but does not modulate proliferation in vitro. Results indicate that ANKHD1 binds to SIVA and has an important role in inducing leukemia cell proliferation and migration via the Stathmin 1 pathway. ANKHD1 may be an oncogene and participate in the leukemia cell phenotype.

Epigenetic Silencing of CRABP2 and MX1 in Head and Neck Tumors

Head and neck squamous cell carcinoma (HNSCC) is a heterogeneous disease affecting the epithelium of the oral cavity, pharynx and larynx. Conditions of most patients are diagnosed at late stages of the disease, and no sensitive and specific predictors of aggressive behavior have been identified yet. Therefore, early detection and prognostic biomarkers are highly desirable for a more rational management of the disease. Hypermethylation of CpG islands is one of the most important epigenetic mechanisms that leads to gene silencing in tumors and has been extensively used for the identification of biomarkers. In this study, we combined rapid subtractive hybridization and microarray analysis in a hierarchical manner to select genes that are putatively reactivated by the demethylating agent 5-aza-2'-deoxycytidine (5Aza-dC) in HNSCC cell lines (FaDu, UM-SCC-14A, UM-SCC-17A, UM-SCC-38A). This combined analysis identified 78 genes, 35 of which were reactivated in at least 2 cell lines and harbored a CpG island at their 5' region. Reactivation of 3 of these 35 genes (CRABP2, MX1, and SLC15A3) was confirmed by quantitative real-time polymerase chain reaction (PCR; fold change, >= 3). Bisulfite sequencing of their CpG islands revealed that they are indeed differentially methylated in the HNSCC cell lines. Using methylation-specific PCR, we detected a higher frequency of CRABP2 (58.1% for region 1) and MX1 (46.3%) hypermethylation in primary HNSCC when compared with lymphocytes from healthy individuals. Finally, absence of the CRABP2 protein was associated with decreased disease-free survival rates, supporting a potential use of CRABP2 expression as a prognostic biomarker for HNSCC patients.

Gene silencing during development of in vitro-produced female bovine embryos

In early development, female embryos (XX) produce twice the transcripts of X-linked genes compared with male embryos (XY). During the course of development, inactivation of the X chromosome equilibrates gene dosage, making the development of female embryos viable. Moreover, the biotechnologies used for producing embryos in vitro seem to work better with male embryos, making it easier for them to reach the blastocyst stage and allow for complete gestation. We investigated the expression of three X-linked genes that are involved in development, XIST, G6PD, and HPRT, and of the transcript interferon-tau, in male and female bovine blastocysts produced by nuclear transfer (NT) and by in vitro fertilization (IVF). Oocytes that had been matured in vitro were enucleated and reconstructed with somatic cells from adult animals at 18 h post-maturation. After fusion (two pulses of 2.25 kv/cm) and chemical activation (5.0 mu M ionomycin for 5 min and 2.0 mM 6-DMAP for 3 h), the oocytesomatic cell units were cultivated in CR2 with a monolayer of granulosa cells at 38.8 degrees C, in a humidified 5% CO(2) atmosphere. IVF embryos were inseminated, after centrifugation in a Percoll gradient, with 2 x 10(6) sperm/mL TALP medium supplemented with BSA and PHE and cultivated under the same conditions as the cloned embryos. We used real-time PCR to analyze the gene expression of individual blastocysts compared to expression of the housekeeping gene, GAPDH. The gene XIST was expressed in female embryos and not in male embryos produced by IVF, though it was expressed at low levels in male embryos produced by NT. Unlike previous reports, we found lower levels of the transcript of G6PD in females than in males, suggesting double silencing or other mechanisms of control of this gene. Female embryos produced by IVF expressed the HPRT gene at a higher level than female embryos produced by NT, suggesting that gene silencing proceeds faster in NT-produced female embryos due to ""inactivation memory"" from the nucleus donor. In conclusion, male and female embryos express different levels of X-chromosome genes and failures of these genes that are essential for development could reduce the viability of females. Nuclear transfer can modify this relation, possibly due to epigenetic memory, leading to frequent failures in nuclear reprogramming.

Silencing of mitochondrial alternative oxidase gene of Aspergillus fumigatus enhances reactive oxygen species production and killing of the fungus by macrophages

We previously demonstrated that conidia from Aspergillus fumigatus incubated with menadione and paraquat increases activity and expression of cyanide-insensitive alternative oxidase (AOX). Here, we employed the RNA silencing technique in A. fumigatus using the vector pALB1/aoxAf in order to down-regulate the aox gene. Positive transformants for aox gene silencing of A. fumigatus were more susceptible both to an imposed in vitro oxidative stress condition and to macrophages killing, suggesting that AOX is required for the A. fumigatus pathogenicity, mainly for the survival of the fungus conidia during host infection and resistance to reactive oxygen species generated by macrophages.

A non-invasive method for silencing gene transcription in honeybees maintained under natural conditions

in the Apis mellifera post-genomic era, RNAi protocols have been used in functional approaches. However, sample manipulation and invasive methods such as injection of double-stranded RNA (dsRNA) can compromise physiology and survival. To circumvent these problems, we developed a non-invasive method for honeybee gene knockdown, using a well-established vitellogenin RNAi system as a model. Second instar larvae received dsRNA for vitellogenin (dsVg-RNA) in their natural diet. For exogenous control, larvae received dsRNA for GFP (dsGFP-RNA). Untreated larvae formed another control group. Around 60% of the treated larvae naturally developed until adult emergence when 0.5 mu g of dsVg-RNA or dsGFP-RNA was offered while no larvae that received 3.0 mu g of dsRNA reached pupal stages. Diet dilution did not affect the removal rates. Viability depends not only on the delivered doses but also on the internal conditions of colonies. The weight of treated and untreated groups showed no statistical differences. This showed that RNAi ingestion did not elicit drastic collateral effects. Approximately 90% of vitellogenin transcripts from 7-day-old workers were silenced compared to controls. A large number of samples are handled in a relatively short time and smaller quantities of RNAi molecules are used compared to invasive methods. These advantages culminate in a versatile and a cost-effective approach. (c) 2008 Elsevier Ltd. All rights reserved.

RNAi-mediated silencing of vitellogenin gene function turns honeybee (Apis mellifera) workers into extremely precocious foragers

The switch from within-hive activities to foraging behavior is a major transition in the life cycle of a honeybee (Apis mellifera) worker. A prominent regulatory role in this switch has long been attributed to juvenile hormone (JH), but recent evidence also points to the yolk precursor protein vitellogenin as a major player in behavioral development. In the present study, we injected vitellogenin double-stranded RNA (dsVg) into newly emerged worker bees of Africanized genetic origin and introduced them together with controls into observation hives to record flight behavior. RNA interference-mediated silencing of vitellogenin gene function shifted the onset of long-duration flights (> 10 min) to earlier in life (by 3-4 days) when compared with sham and untreated control bees. In fact, dsVg bees were observed conducting such flights extremely precociously, when only 3 days old. Short-duration flights (< 10 min), which bees usually perform for orientation and cleaning, were not affected. Additionally, we found that the JH titer in dsVg bees collected after 7 days was not significantly different from the controls. The finding that depletion of the vitellogenin titer can drive young bees to become extremely precocious foragers could imply that vitellogenin is the primary switch signal. At this young age, downregulation of vitellogenin gene activity apparently had little effect on the JH titer. As this unexpected finding stands in contrast with previous results on the vitellogenin/JH interaction at a later age, when bees normally become foragers, we propose a three-step sequence in the constellation of physiological parameters underlying behavioral development.

Silencing of LRRC49 and THAP10 genes by bidirectional promoter hypermethylation is a frequent event in breast cancer

Previously we found that levels of LRRC49 (leucine rich repeat containing 49; FLJ20156) transcripts were elevated in ER-positive breast tumors compared with ER-negative breast tumors. The LRRC49 gene is located on chromosome 15q23 in close proximity to the THAP10 (THAP domain containing 10) gene. These two genes have a bidirectional organization being arranged head-to-head on opposite strands, possibly sharing the same promoter region. Analysis of the promoter region of this gene pair revealed the presence of potential estrogen response elements (EREs), suggesting the potential of this promoter to be under the control of estrogen. We used quantitative real-time PCR (qPCR) to evaluate the expression of LRRC49 and THAP10 in a series of 72 primary breast tumors, and found reduced LRRC49 and THAP10 expression in 61 and 46% of the primary breast tumors analyzed, respectively. In addition, the occurrence of LRRC49/THAP10 promoter hypermethylation was examined by methylation specific PCR (MSP) in a sub-group of the breast tumors. Hypermethylation was observed in 57.5% of the breast tumors analyzed, and the levels of mRNA expression of both genes were inversely correlated with promoter hypermethylation. We investigated the effects of 17 beta-estradiol on LRRC49 and THAP10 expression in MCF-7 breast cancer cells and found both transcripts to be up-regulated 2- to 3-fold upon 17 beta-estradiol treatment. Our results show that the transcripts of LRRC49/THAP10 bidirectional gene pair are co-regulated by estrogen and that hypermethylation of the bidirectional promoter region simultaneously silences both genes. Further studies will be necessary to elucidate the role of LRRC49/THAP10 down-regulation in breast cancer.

Comparative analysis of the expression of cytokeratins (1,10,14,16,4), involucrin, filaggrin and e-cadherin in plane warts and epidermodysplasia verruciformis plane wart-type lesions

Background: Epidermodysplasia verruciformis (EV) is a rare genodermatosis with susceptibility to human papillomavirus (HPV) infection, and high risk of skin cancer considered a model of viral oncogenesis. Methods: Fifteen cases of EV plane wart (PW)-type lesions (EV) and 14 cases of PW in healthy individuals were subjected to immunohistochemical technique for cytokeratins (K) 1, 10, 14, 16, 4, involucrin, filaggrin and e-cadherin. Results: K1/10 showed retarded or negative expression in EV, being substituted by K14. Expression of K14 occurred in the basal and suprabasal layers in both groups, but in EV, its expression was observed up to the more superficial layers. Both groups showed positivity for K16 and K4, involucrin expression in lower levels of the spinous layer and unaltered filaggrin expression. E-cadherin expression was diminished at the koilocytotic foci of both lesions, more superficially in EV. Conclusion: Infection by HPV may alter the differentiation status of the epidermis, leading to a major expression of K14, delayed or absent expression of K1/10 and earlier involucrin expression, especially in EV. It also stimulates the expression of K16 and K4. Filaggrin expression is not altered, and e-cadherin is diminished in superficial koilocytotic cells` foci in EV.

Silencing of HTLV-1 gag and env genes by small interfering RNAs in HEK 293 cells

Since the discovery of RNAi technology, several functional genomic and disease therapy studies have been conducted using this technique in the field of oncology and virology. RNAi-based antiviral therapies are being studied for the treatment of retroviruses such as HIV-1. These studies include the silencing of regulatory, infectivity and structural genes. The HTLV-1 structural genes are responsible for the synthesis of proteins involved in the entry, assembly and release of particles during viral infection. To examine the possibility of silencing HTLV-1 genes gag and env by RNA interference technology, these genes were cloned into reporter plasmids. These vectors expressed the target mRNAs fused to EGFP reporter genes. Three small interference RNAs (siRNAs) corresponding to gag and three corresponding to env were designed to analyze the effect of silencing by RNAi technology. The plasmids and siRNAs were co-transfected into HEK 293 cells. The results demonstrated that the expression of the HTLV-1 gag and env genes decreased significantly in vitro. Thus, siRNAs can be used to inhibit HTLV-1 structural genes in transformed cells, which could provide a tool for clarifying the roles of HTLV-1 structural genes, as well as a therapy for this infection. (C) 2011 Elsevier B.V. All rights reserved.

Tubulin cofactor A gene silencing in mammalian cells induces changes in microtubule cytoskeleton, cell cycle arrest and cell death

Microtubules are polymers of alpha/beta-tubulin participating in essential cell functions. A multistep process involving distinct molecular chaperones and cofactors produces new tubulin heterodimers competent to polymerise. In vitro cofactor A (TBCA) interacts with beta-tubulin in a quasi-native state behaving as a molecular chaperone. We have used siRNA to silence TBCA expression in HeLa and MCF-7 mammalian cell lines. TBCA is essential for cell viability and its knockdown produces a decrease in the amount of soluble tubulin, modifications in microtubules and G1 cell cycle arrest. In MCF-7 cells, cell death was preceded by a change in cell shape resembling differentiation.