23 resultados para Filaggrin
Resumo:
Background: Epidermodysplasia verruciformis (EV) is a rare genodermatosis with susceptibility to human papillomavirus (HPV) infection, and high risk of skin cancer considered a model of viral oncogenesis. Methods: Fifteen cases of EV plane wart (PW)-type lesions (EV) and 14 cases of PW in healthy individuals were subjected to immunohistochemical technique for cytokeratins (K) 1, 10, 14, 16, 4, involucrin, filaggrin and e-cadherin. Results: K1/10 showed retarded or negative expression in EV, being substituted by K14. Expression of K14 occurred in the basal and suprabasal layers in both groups, but in EV, its expression was observed up to the more superficial layers. Both groups showed positivity for K16 and K4, involucrin expression in lower levels of the spinous layer and unaltered filaggrin expression. E-cadherin expression was diminished at the koilocytotic foci of both lesions, more superficially in EV. Conclusion: Infection by HPV may alter the differentiation status of the epidermis, leading to a major expression of K14, delayed or absent expression of K1/10 and earlier involucrin expression, especially in EV. It also stimulates the expression of K16 and K4. Filaggrin expression is not altered, and e-cadherin is diminished in superficial koilocytotic cells` foci in EV.
Resumo:
Introduction: Evidence suggests that citrullinated fibrin(ogen) may be a potential in vivo target of anticitrullinated protein/peptide antibodies (ACPA) in rheumatoid arthritis (RA). We compared the diagnostic yield of three enzyme-linked immunosorbent assay (ELISA) tests by using chimeric fibrin/filaggrin citrullinated synthetic peptides (CFFCP1, CFFCP2, CFFCP3) with a commercial CCP2-based test in RA and analyzed their prognostic values in early RA. Methods: Samples from 307 blood donors and patients with RA (322), psoriatic arthritis (133), systemic lupus erythematosus (119), and hepatitis C infection (84) were assayed by using CFFCP- and CCP2-based tests. Autoantibodies also were analyzed at baseline and during a 2-year follow-up in 98 early RA patients to determine their prognostic value. Results: With cutoffs giving 98% specificity for RA versus blood donors, the sensitivity was 72.1% for CFFCP1, 78.0% for CFFCP2, 71.4% for CFFCP3, and 73.9% for CCP2, with positive predictive values greater than 97% in all cases. CFFCP sensitivity in RA increased to 80.4% without losing specificity when positivity was considered as any positive anti-CFFCP status. Specificity of the three CFFCP tests versus other rheumatic populations was high (> 90%) and similar to those for the CCP2. In early RA, CFFCP1 best identified patients with a poor radiographic outcome. Radiographic progression was faster in the small subgroup of CCP2-negative and CFFCP1-positive patients than in those negative for both autoantibodies. CFFCP antibodies decreased after 1 year, but without any correlation with changes in disease activity. Conclusions: CFFCP-based assays are highly sensitive and specific for RA. Early RA patients with anti-CFFCP1 antibodies, including CCP2-negative patients, show greater radiographic progression.
Resumo:
Introduction: Evidence suggests that citrullinated fibrin(ogen) may be a potential in vivo target of anticitrullinated protein/peptide antibodies (ACPA) in rheumatoid arthritis (RA). We compared the diagnostic yield of three enzyme-linked immunosorbent assay (ELISA) tests by using chimeric fibrin/filaggrin citrullinated synthetic peptides (CFFCP1, CFFCP2, CFFCP3) with a commercial CCP2-based test in RA and analyzed their prognostic values in early RA. Methods: Samples from 307 blood donors and patients with RA (322), psoriatic arthritis (133), systemic lupus erythematosus (119), and hepatitis C infection (84) were assayed by using CFFCP- and CCP2-based tests. Autoantibodies also were analyzed at baseline and during a 2-year follow-up in 98 early RA patients to determine their prognostic value. Results: With cutoffs giving 98% specificity for RA versus blood donors, the sensitivity was 72.1% for CFFCP1, 78.0% for CFFCP2, 71.4% for CFFCP3, and 73.9% for CCP2, with positive predictive values greater than 97% in all cases. CFFCP sensitivity in RA increased to 80.4% without losing specificity when positivity was considered as any positive anti-CFFCP status. Specificity of the three CFFCP tests versus other rheumatic populations was high (> 90%) and similar to those for the CCP2. In early RA, CFFCP1 best identified patients with a poor radiographic outcome. Radiographic progression was faster in the small subgroup of CCP2-negative and CFFCP1-positive patients than in those negative for both autoantibodies. CFFCP antibodies decreased after 1 year, but without any correlation with changes in disease activity. Conclusions: CFFCP-based assays are highly sensitive and specific for RA. Early RA patients with anti-CFFCP1 antibodies, including CCP2-negative patients, show greater radiographic progression.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Filaggrin loss-of-function mutations resulting in C-terminal protein truncations are strong predisposing factors in human atopic dermatitis (AD). To assess the possibility of similar truncations in canine AD, an exclusion strategy was designed on 16 control and 18 AD dogs of various breeds. Comparative immunofluorescence microscopy was performed with an antibody raised against the canine filaggrin C-terminus and a commercial N-terminal antibody. Concurrent with human AD-like features such as generalized NFKB activation and hyperproliferation, four distinctive filaggrin expression patterns were identified in non-lesional skin. It was found that 10/18 AD dogs exhibited an identical pattern for both antibodies with comparable (category I, 3/18) or reduced (category II, 7/18) expression to that of controls. In contrast, 4/18 dogs displayed aberrant large vesicles revealed by the C-terminal but not the N-terminal antibody (category III), while 4/18 showed a control-like N-terminal expression but lacked the C-terminal protein (category IV). The missing C-terminal filaggrin in category IV strongly points towards loss-of function mutations in 4/18 (22%) of all AD dogs analysed.
Resumo:
Background Molluscum contagiosum (MC) is a Molluscipox virus infection of keratinocytes with hyperplasia and intracytoplasmic inclusions-the molluscum bodies (MBs). Few papers address cytokeratins (K) profile in MC, mainly focusing terminal keratinization process. Methods Forty-one MC lesions were subjected to immunohistochemical technique to verify K1, K10, K14, K16, involucrin, filaggrin, E-cadherin and p63 expression. MC immunolabeling pattern was compared to adjacent normal appearing epidermis (ANAE). Results In MC and ANAE, K1/K10 were expressed in suprabasal layers, K14 was expressed in basal and suprabasal layers and K16 was expressed through all spinous layer. Involucrin and filaggrin were observed in granular, spinous and in basal layer of ANAE and MC. E-cadherin was present up to the first layers of MC while ANAE exhibited E-cadherin labeling at basal and spinous layers. Basal and spinous layers keratinocytes nuclei, in both MC and ANAE, express p63. Conclusion Infection by Molluscipox virus alters keratinocyte differentiation status. The presence of K14 and p63 in spinous layer, as well as early expression of involucrin and filaggrin, associated to a hyperproliferative state disclosed by K16 expression, may be a result of disruption in keratinocytes maturation process. The changes observed at ANAE may represent early events in keratinization disturbance. Callegaro CF, Sotto MN. Molluscum contagiosum: immunomorphological aspects of keratinocytes markers of differentiation and adhesion.
Resumo:
Filaggrin is a keratin filament associated protein that is expressed in granular layer keratinocytes and derived by sequential proteolysis from a polyprotein precursor termed profilaggrin. Depending on the species, each profilaggrin molecule contains between 10 and 20 filaggrin subunits organized as tandem repeats with a calcium-binding domain at the N-terminal end. We now report the characterization of the complete mouse gene. The structural organization of the mouse gene is identical to the human profilaggrin gene and consists of three exons with a 4 kb intron within the 5' noncoding region and a 1.7 kb intron separating the sequences encoding the calcium-binding EF-hand motifs. A processed pseudogene was found embedded within the second intron. The third and largest exon encodes the second EF-hand, a basic domain (designated the B-domain) followed by 12 filaggrin repeats and a unique C-terminal tail domain. A polyclonal anti-body raised against the conceptually translated sequence of the B-domain specifically stained keratohyalin granules and colocalized with a filaggrin antibody in granular layer cells. In upper granular layer cells, B-domain containing keratohyalin granules were in close apposition to the nucleus and, in some cells, appeared to be completely engulfed by the nucleus. In transition layer cells, B-domain staining was evident in the nucleus whereas filaggrin staining remained cytoplasmic. Nuclear staining of the B-domain was also observed in primary mouse keratinocytes induced to differentiate. This study has also revealed significant sequence homology between the mouse and human promoter sequences and in the calcium-binding domain but the remainder of the protein-coding region shows substantial divergence.
Resumo:
Summary: The mammalian epidermis is a pluristratified epithelium composed of 90% keratinocytes, and its main function is to serve as barrier for the body. The epithelial sodium channel (ENaC), formed by three homologous subunits α, β and γ is found in a variety of epithelia including epidermis. Previous studies showed that ENaC modulates different aspects of epidermal differentiation, such as synthesis of differentiation-specific proteins and lipid secretion. ENaC plays also a critical role in sodium homeostasis of renal and pulmonary epithelia, and its activity is thereby well controlled by hormones and non-hormonal factors, such as the serine protease CAP1 (channel-activating protease 1), also termed prostasin encoded by Prss8 gene. Serine proteases are proteolytic enzymes involved in numerous physiological and pathological processes in the epidermis. In order to evaluate the role of β and γENaC in epidermis, we analyzed the skin phenotype of β and γENaC null mutant (βENaC-/- and γENaC-/-) mice in comparison with the phenotype of αENaC-deficient mice. Furthermore, keratin14-specific CAP1-deficient mice (Prss8lox/Δ /K14-Cre) were generated in order to unveil the role of the serine protease CAP1 in epidermal development and function. This study reveals that the skin phenotype of βENaC and γENaC null mutant mice is less severe than the one of αENaC-deficient mice. However, all these mice present a common premature lipid secretion in the mid-granular layer of the epidermis. Further, the composition of the lipids of the stratum corneum in αENaC-deficient mice is strongly altered, suggesting that epidermal barrier function is compromised. K14-specific CAP1-deficient newborn mice are born at the expected Mendelian ratio, but die soon after birth, showing that CAP1 is required for postnatal survival. The epidermis of these mice exhibits striking malformations of the stratum corneum showing hyperkeratosis. These defects seriously affect both inward and outward epidermal barrier function, leading to rapid and fatal dehydration. As in αENaC-deficient mice, the lipid composition of the stratum corneum of K14-specific CAP1-deficient mice is disturbed. Furthermore, lack of CAP1 leads to the selective loss of filaggrin monomers, important for keratins aggregation and skin moisturization, and to an increased of aberrant profilaggrin precursors. In conclusion, both ENaC and CAP1 expression in the epidermis are crucial for keratinocyte differentiation processes and/or barrier function. Since the abnormalities in K14-specific CAP1-deficient mice resemble key features of human skin ichthyosis, in particular Harlequin ichthyosis, the study of ENaC and CAP1 mutant mice might allow new insights into mechanisms underlying skin diseases. Résumé: L'épiderme des mammifères est un épithélium pluristratifié, protégeant le corps contre les perturbations extérieures et la déshydratation. Le canal épithélial à sodium (ENaC), formé de trois sous-unités α, β et γ, est exprimé dans de nombreux épithélia, comme l'épiderme. Des études ont montré que l'absence de la sous-unité αENaC modulait différents aspects de la différenciation des kératinocytes de l'épiderme, comme la synthèse de protéines spécifiques ou la sécrétion de lipides dans la couche granulaire de l'épiderme. ENaC joue également un rôle crucial dans l'homéostasie du sodium dans les épithélia électriquement étanches, comme l'épithélium rénal ou pulmonaire. L'activité de ENaC est par conséquent finement régulée, en partie par des hormones, mais aussi par des facteurs non-hormonaux, telle que la sérine protéase CAP1 (« channel-activating protease 1 >>) (nommée également prostasine et codée par le gène Prss8). Le but de ce travail a donc été d'étudier le rôle des sous-unités β et γENaC dans l'épiderme en comparaison avec celui de la sous-unité α en utilisant des souris mutantes βENaC-/- et γENaC-/-. Dans un deuxième temps, le phénotype d'une souris chez qui CAP1 a été spécifiquement invalidé dans l'épiderme (Prsslox/Δ/K14-Cre) a été analysé, dans le but de mettre en évidence le rôle de cette protéase dans l'épiderme. Comme déjà montré pour les souris αENaC-/-, la sécrétion des lipides dans la couche granulaire de l'épiderme des souris βENaC-/- et γENaC-/- est prématurée. Cependant, l'hyperplasie et l'expression anormale des protéines marqueurs de la différenciation présents chez les souris αENaC-/- n'ont pas été observés dans l'épiderme des souris βENaC-/- et γENaC-/-. La composition lipidique de la couche cornée des souris αENaC-/- est fortement altérée suggérant que la fonction de barrière de l'épiderme de ces souris est compromise. Les souris mutantes CAP1 ont quant à elles révélé des malformations sévères de leur couche cornée, affectant la fonction de barrière de leur épiderme et conduisant à la mort de ces souris par déshydratation quelques jours après leur naissance. De plus, la composition en lipides de la couche cornée ainsi que la taille des cellules cornées, les cornéocytes, de ces souris sont modifiées par rapport aux souris contrôles. L'invalidation de la protéine CAP1 dans l'épiderme conduit aussi à la perte de la filaggrine, une protéine cruciale pour l'agrégation des kératines dans la couche cornée et le maintien du niveau d'hydratation de la peau, et à l'accumulation de ses précurseurs. En conclusion, l'expression de ENaC et de CAP1 est cruciale pour la différenciation de l'épiderme et/ou sa fonction de barrière. De plus, le phénotype des souris mutantes CAP1 présente des caractéristiques qui ressemblent à celles observées dans certaines pathologies humaines cutanées, comme l'ichthyose d'Harlequin. L'étude des souris mutantes ENaC et CAP1 pourrait donc apporter de nouvelles connaissances dans les mécanismes impliqués dans l'ichthyose d'Harlequin ou d'autres maladies de la peau chez l'homme. Résumé tout public: La peau est le plus grand organe vital du corps humain. Sa fonction principale est de protéger le corps comme une barrière, contre les agressions extérieures et la déshydratation. De nombreuses maladies de la peau résultent d'une perte de fonction de cette barrière. Bien que les pathologies cutanées soient très bien décrites, leur cause génétique n'est en général pas encore connue. La souris est alors un modèle de choix pour la recherche fondamentale. En effet, grâce aux progrès récents de la science, le génome de la souris peut aujourd'hui être modifié dans le but d'étudier le rôle de nombreuses protéines. Dans différents organes, comme le rein et le poumon, le canal épithélial à sodium (ENaC), composé de trois sous-unités protéiques homologues (α, β, et γ), joue un rôle essentiel dans la réabsorption du sodium. L'activité de ENaC est régulée par de nombreux facteurs hormonaux et non-hormonaux, telle que la protéase CAP1 (« channel-activating protease 1 »). L'invalidation de la sous-unité αENaC chez la souris a permis de montrer que dans la peau, le canal ENaC est impliqué dans la différenciation des cellules de l'épiderme et la croissance des poils. Durant ce travail, le phénotype des souris chez qui la protéine βENaC, γENaC ou CAP1 a été invalidée (souris mutantes), a été étudié dans le but de mieux comprendre le rôle des sous-unités du canal ENaC et de son régulateur CAP1 dans la peau. Les résultats de ce projet ont montré que les souris mutantes βENaC et γENaC présentent un épiderme anormal avec une synthèse prématurée de lipides dans la couche granulaire, suggérant l'implication de ENaC dans la fonction de barrière de la peau. De plus, quand CAP1 est invalidé de manière totale chez les souris, le développement embryonnaire est perturbé et ces souris meurent avant la naissance. CAP1 a donc été invalidé spécifiquement dans l'épiderme des souris. Ces souris mutantes « épiderme-spécifique » naissent normalement, mais meurent peu après la naissance de déshydratation. La couche superficielle de l'épiderme, appelée couche cornée, de ces souris est malformée et ne confère plus à la peau sa fonction de barrière. De plus, les composants de la couche cornée, les cellules cornées entourées de lipides, sont sévèrement altérés. Le phénotype de ces souris ressemble aux caractéristiques présentes chez les patients atteints d'ichthyoses, en particulier l'ichthyose d'Harlequin. En conclusion, le canal ENaC ainsi que son régulateur CAP1 jouent un rôle clé dans les processus de différenciation de l'épiderme et/ou de sa fonction de barrière. De plus, les souris mutantes pour CAP1 et ENaC se révéleront peut-être comme des modèles appropriés dans l'étude de l'ichthyose d'Harlequin ou d'autres maladies cutanées.
Resumo:
Previous studies demonstrated that peroxisome-proliferator-activated receptor (PPAR)-alpha or PPAR-delta activation stimulates keratinocyte differentiation, is anti-inflammatory, and improves barrier homeostasis. Here we demonstrate that treatment of cultured human keratinocytes with ciglitazone, a PPAR-gamma activator, increases involucrin and transglutaminase 1 mRNA levels. Moreover, topical treatment of hairless mice with ciglitazone or troglitazone increases loricrin, involucrin, and filaggrin expression without altering epidermal morphology. These results indicate that PPAR-gamma activation stimulates keratinocyte differentiation. Additionally, PPAR-gamma activators accelerated barrier recovery following acute disruption by either tape stripping or acetone treatment, indicating an improvement in permeability barrier homeostasis. Treatment with PPAR-gamma activators also reduced the cutaneous inflammatory response that is induced by phorbol 12-myristate-13-acetate, a model of irritant contact dermatitis and oxazolone, a model of allergic contact dermatitis. To determine whether the effects of PPAR-gamma activators are mediated by PPAR-gamma, we next examined animals deficient in PPAR-gamma. Mice with a deficiency of PPAR-gamma specifically localized to the epidermis did not display any cutaneous abnormalites on inspection, but on light microscopy there was a modest increase in epidermal thickness associated with an increase in proliferating cell nuclear antigen (PCNA) staining. Key functions of the skin including permeability barrier homeostasis, stratum corneum surface pH, and water-holding capacity, and response to inflammatory stimuli were not altered in PPAR-gamma-deficient epidermis. Although PPAR-gamma activators stimulated loricrin and filaggrin expression in wild-type animals, however, in PPAR-gamma-deficient mice no effect was observed indicating that the stimulation of differentiation by PPAR-gamma activators is mediated by PPAR-gamma. In contrast, PPAR-gamma activators inhibited inflammation in both PPAR-gamma-deficient and wild-type mouse skin, indicating that the inhibition of cutaneous inflammation by these PPAR-gamma activators does not require PPAR-gamma in keratinocytes. These observations suggest that thiazolidindiones and perhaps other PPAR-gamma activators maybe useful in the treatment of cutaneous disorders.
Resumo:
The TRAF-interacting protein (TRIP/TRAIP) is a RING-type E3 ubiquitin ligase inhibiting tumor necrosis factor-α (TNF-α)-mediated NF-κB activation. TRIP ablation results in early embryonic lethality in mice. To investigate TRIP function in epidermis, we examined its expression and the effect of TRIP knockdown (KD) in keratinocytes. TRIP mRNA expression was strongly downregulated in primary human keratinocytes undergoing differentiation triggered by high cell density or high calcium. Short-term phorbol-12-myristate-13-acetate (TPA) treatment or inhibition of phosphatidylinositol-3 kinase signaling in proliferative keratinocytes suppressed TRIP transcription. Inhibition by TPA was protein kinase C dependent. Keratinocytes undergoing KD of TRIP expression by lentiviral short-hairpin RNA (shRNA; T4 and T5) had strongly reduced proliferation rates compared with control shRNA. Cell cycle analysis demonstrated that TRIP-KD caused growth arrest in the G1/S phase. Keratinocytes with TRIP-KD resembled differentiated cells consistent with the augmented expression of differentiation markers keratin 1 and filaggrin. Luciferase-based reporter assays showed no increase in NF-κB activity in TRIP-KD keratinocytes, indicating that NF-κB activity in keratinocytes is not regulated by TRIP. TRIP expression was increased by ∼2-fold in basal cell carcinomas compared with normal skin. These results underline the important role of TRIP in the regulation of cell cycle progression and the tight linkage of its expression to keratinocyte proliferation.
Resumo:
Loss-of-function mutations in human profilaggrin gene have been identified as the cause of ichthyosis vulgaris (IV), and as a major predisposition factor for atopic dermatitis (AD). Similarly, flaky tail (a/a ma ft/ma ft/J) mice were described as a model for IV, and shown to be predisposed to eczema. The aim of this study was to correlate the flaky tail mouse phenotype with human IV and AD, in order to dissect early molecular events leading to atopic dermatitis in mice and men, suffering from filaggrin deficiency. Thus, 5-days old flaky tail pups were analyzed histologically, expression of cytokines was measured in skin and signaling pathways were investigated by protein analysis. Human biopsies of IV and AD patients were analyzed histologically and by real time PCR assays. Our data show acanthosis and hyperproliferation in flaky tail epidermis, associated with increased IL1β and thymic stromal lymphopoietin (TSLP) expression, and Th2-polarization. Consequently, NFκB and Stat pathways were activated, and IL6 mRNA levels were increased. Further, quantitative analysis of late epidermal differentiation markers revealed increased Small proline-rich protein 2A (Sprr2a) synthesis. Th2-polarization and Sprr2a increase may result from high TSLP expression, as shown after analysis of 5-days old K14-TSLP tg mouse skin biopsies. Our findings in the flaky tail mouse correlate with data obtained from patient biopsies of AD, but not IV. We propose that proinflammatory cytokines are responsible for acanthosis in flaky tail epidermis, and together with the Th2-derived cytokines lead to morphological changes. Accordingly, the a/a ma ft/ma ft/J mouse model can be used as an appropriate model to study early AD onset associated with profilaggrin deficiency.
Resumo:
Neuropeptides and their receptors are present in human skin, and their importance for cutaneous homeostasis and during wound healing is increasingly appreciated. However, there is currently a lack of understanding of the molecular mechanisms by which their signaling modulates keratinocyte function. Here, we show that δ-opioid receptor (DOPr) activation inhibits proliferation of human keratinocytes, resulting in decreased epidermal thickness in an organotypic skin model. DOPr signaling markedly delayed induction of keratin intermediate filament (KRT10) during in vitro differentiation and abolished its induction in the organotypic skin model. This was accompanied by deregulation of involucrin (IVL), loricrin, and filaggrin. Analysis of the transcription factor POU2F3, which is involved in regulation of KRT10, IVL, and profilaggrin expression, revealed a DOPr-mediated extracellular signal-regulated kinase (ERK)-dependent downregulation of this factor. We propose that DOPr signaling specifically activates the ERK 1/2 mitogen-activated protein kinase pathway to regulate keratinocyte functions. Complementing our earlier studies in DOPr-deficient mice, these data suggest that DOPr activation in human keratinocytes profoundly influences epidermal morphogenesis and homeostasis.