Genetic evaluation of the mating system in the blue-and-yellow macaw (Ara ararauna, Aves, Psittacidae) by DNA fingerprinting

More than 90% of birds are socially monogamous, although genetic studies indicate that many are often not sexually monogamous. In the present study, DNA fingerprinting was used to estimate the genetic relationships between nestlings belonging to the same broods to evaluate the mating system in the socially monogamous macaw, Ara ararauna. We found that in 10 of 11 broods investigated, the nestlings showed genetic similarity levels congruent with values expected among full-sibs, suggesting that they shared the same parents. However, in one brood, the low genetic similarity observed between nestlings could be a result of intraspecific brood parasitism, intraspecific nest competition or extra-pair paternity. These results, along with available behavioral and life-history data, imply that the blue-and-yellow macaw is not only socially, but also genetically monogamous. However, the occurrence of eventual cases of extra-pair paternity cannot be excluded.

Characterisation of Australian isolates of Fusarium oxysporum f. sp cubense by DNA fingerprinting analysis

Genetic variation among Australian isolates of the fungus Fusarium oxysporum f. sp. cubense (Foc), which causes Fusarium wilt in banana, was examined using DNA amplification fingerprinting (DAF). Ninety-four isolates which represented Races 1, 2, 3, and 4, and vegetative compatibility groups (VCGs) 0120, 0124, 0125, 0128, 0129, 01211, 01213/16, and 01220 were analysed. The genetic relatedness among isolates within each VCG, and between the 8 different VCGs of Foc present in Australia was determined. The DNA fingerprint patterns were VCG-specific, with each VCG representing a unique genotype. The genetic similarity among isolates within each VCG ranged from 97% to 100%. Among the different VCGs of Foc, 3 major clusters were distinguished which corresponded with race. All Race 1 and 2 isolates (VCGs 0124, 0125, 0128, and 01220) were closely related and clustered together, the Race 3 isolates from Heliconia clustered separately, and all Race 4 isolates (VCGs 0120, 0129, 01211, and 01213/16) clustered together. Fifteen isolates from Alstonville, NSW, were characterised because although they were classified as Race 2 based on their recovery from cooking banana cultivars, they belonged in VCG 0124, which had previously contained only Race 1 isolates. The occurrence of more than one race within a VCG means that vegetative compatibility grouping cannot be used to assign pathotype to pathogenic race as previously thought. It was possible to distinguish the Race 1 and Race 2 isolates within VCG 0124 using DNA fingerprinting, as each race produced a unique DNA fingerprint pattern. Among the Australian isolates, DNA fingerprinting analysis identified 9 different VCGs and genotypes of Foc.

A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects

Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular Information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability In three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced similar to 50 scoreable polymorphic DNA markers, between individuals of three Independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from Individual DNA samples that had been combined to create the bulked samples.

Identifying the origin of single corneal cells by DNA fingerprinting - Part I - Implications for corneal limbal allografting

Purpose. To demonstrate that the combination of impression cytology and single cell DNA fingerprinting represents a powerful tool that is suitable for detecting transplanted cells after corneal limbal allografting. Methods, Fifty single cells were obtained by corneal impression cytology from 12 patients undergoing cataract surgery. Individual cells were isolated from samples by micromanipulation. Polymerase chain reaction and short tandem repeat profiling was used to obtain forensic standard DNA fingerprints from single cells. Blood samples taken at the time of impression cytology provided control fingerprints. Results, informative DNA fingerprints were obtained from all corneal samples and 66% (33 of 50 cells) of isolated single cells, Of all fingerprints obtained, most (91%, 30 of 33 fingerprints) corneal fingerprints matched corresponding blond sample fingerprints. At least one corneal fingerprint matched the corresponding blood sample fingerprint in 83% (10 of 12 patients) of the patients in the study, Conclusions. This extremely specific single cell DNA fingerprinting system permits accurate identification of individual corneal epithelial cells, allowing very reliable determination of their origin, which will enable host and donor cells to be distinguished from each other after keratolimbal allografting procedures. even if the host and donor are the same sex or siblings. These DNA fingerprinting methods allow assessment of quality and quantity of donor cell survival, as well as survival time. The extreme sensitivity and accuracy of the technique means that should contamination occur, it would be identified, thus ensuring meaningful results.

A genetic map of macadamia based on randomly amplified DNA fingerprinting (RAF) markers

The first genetic linkage map of macadamia (Macadamia integrifolia and M. tetraphylla) is presented. The map is based on 56 F-1 progeny of cultivars 'Keauhou' and 'A16'. Eighty-four percent of the 382 markers analysed segregated as Mendelian loci. The two-way pseudo-testcross mapping strategy allowed construction of separate parental cultivar maps. Ninety bridging loci enabled merging of these maps to produce a detailed genetic map of macadamia, 1100 cM in length and spanning 70-80% of the genome. The combined map comprised 24 linkage groups with 265 framework markers: 259 markers from randomly amplified DNA fingerprinting (RAF), five random amplified polymorphic DNA (RAPD), and one sequence-tagged microsatellite site (STMS). The RAF marker system unexpectedly revealed 16 codominant markers, one of them a putative microsatellite locus and exhibiting four distinct alleles in the cross. This molecular study is the most comprehensive examination to date of genetic loci of macadamia, and is a major step towards developing marker-assisted selection for this crop.

DNA fingerprinting of glioma cell lines and considerations on similarity measurements.

Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

Typing Candida albicans oral isolates from human immunodeficiency virus-infected patients by multilocus enzyme electrophoresis and DNA fingerprinting.

A total of 189 Candida albicans isolates have been typed by multilocus enzyme electrophoresis. The results obtained confirm the clonal mode of reproduction of C. albicans. The C. albicans populations found in the oropharynx of human immunodeficiency virus (HIV)-infected patients, in the oropharynx of healthy carriers, or in association with invasive candidiasis could not be distinguished. No clone or group of clones could be associated with the appearance of clinical disorders or with a reduced in vitro susceptibility to the antifungal agent fluconazole. Multiple and sequential oral isolates from 24 HIV-infected patients were also typed by restriction enzyme analysis with the enzymes EcoRI and HinfI and by use of the Ca3 repetitive probe. The results obtained by the combination of all three typing methods show that all but one patient each carried a unique major C. albicans clone in their oropharynx. The 21 patients with sequential isolates had the same C. albicans clones in their throats during recurrent oropharyngeal candidiasis episodes, independently of clinical status or of changes of in vitro susceptibility to fluconazole. Finally, several isolates of the same C. albicans clone found simultaneously in the oropharynx of a patient may present different levels of susceptibility to fluconazole.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

DNA fingerprinting of Mycobacterium tuberculosis from patients with and without AIDS in Rio de Janeiro

Isolates of Mycobacterium tuberculosis derived from patients with AIDS from a single hospital in Rio de Janeiro were typed using a standardized RFLP technique detecting IS6110 polymorphism. Nineteen isolates were obtained from 15 different patients. Eleven distinct IS6110 patterns were found, with 4 banding patterns shared by 2 patients. The clustering value of 53% was much higher in comparison with clustering of M. tuberculosis strains from TB patients without clinical signs for HIV infection from randomly selected health centers. We present these results as preliminary data on M. tuberculosis strain polymorphism in Brazil and on the higher risk for recent transmission amongst patients with AIDS

Multilocus DNA fingerprinting reveals high rate of heritable genetic mutation in herring gulls nesting in an industrialized urban site.

Genotoxins, such as polycyclic aromatic compounds, are ubiquitous in urban and industrial environments. Our understanding of the role that these chemicals play in generating DNA sequence mutations is predominantly derived from laboratory studies with specific genotoxins or extracts of contaminants from environmental media. Most assays are not indicative of the germinal effects of exposure in situ to complex mixtures of common environmental mutagens. Using multilocus DNA fingerprinting, we found the mutation rate in herring gulls inhabiting a heavily industrialized urban harbor (Hamilton Harbour, Ontario) to be more than twice as high as three rural sites: Kent Island, Bay of Fundy; Chantry Island, Lake Huron; and Presqu'ile Provincial Park in Lake Ontario. Overall we found a mutation rate of 0.017 +/- 0.004 per offspring band in Hamilton, 0.006 +/- 0.002 at Kent Island, 0.002 +/- 0.002 from Chantry Island, and 0.004 +/- 0.002 from Presqu'ile Provincial Park. The mutation rate from the rural sites (pooled) was significantly lower than the rate observed in Hamilton Harbour (Fisher's exact test, two-tailed; P = 0.0006). These minisatellite DNA mutations may be important biomarkers for heritable genetic changes resulting from in situ exposure to environmental genotoxins in a free-living vertebrate species.

Genomic DNA fingerprinting by restriction fragment end labeling.

A typing method for bacteria was developed and applied to several species, including Escherichia coli and Actinobacillus actinomycetemcomitans. Total genomic DNA was digested with a restriction endonuclease, and fragments were enabled with [alpha-32P]dATP by using the Klenow fragment of DNA polymerase and separated by electrophoresis in 6% polyacrylamide/8 M urea (sequencing gel). Depending on the restriction endonuclease and the bacterium, the method produced approximately 30-50 well-separated fragments in the size range of 100-400 nucleotides. For A. actinomycetemcomitans, all strains had bands in common. Nevertheless, many polymorphisms could be observed, and the 31 strains tested could be classified into 29 distinct types. Furthermore, serotype-specific fragments could be assigned for the three serotypes investigated. The method described is very sensitive, allowing more distinct types to be distinguished than other commonly used typing methods. When the method was applied to 10 other clinically relevant bacterial species, both species-specific bands and strain-specific bands were found. Isolates from different locations of one patient showed indistinguishable patterns. Computer-assisted analysis of the DNA fingerprints allowed the determination of similarity coefficients. It is concluded that genomic fingerprinting by restriction fragment end labeling (RFEL) is a powerful and generally applicable technique to type bacterial species.