916 resultados para Detection of flaws


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Indirect Fluorescence Assay (IFA) and the indirect ELISA were comparatively used to detect IgG and IgM antibodies for Toxoplasma gondii in experimentally and naturally infected primates. In the experimentally infected group, antibodies of diagnostic value were detected at day 9 post-infection (PI) with the IFA (IgG and IgM) and with IgG-ELISA. IgM-ELISA detected antibodies for T. gondii starting at day 3 PI until the end of the experiment (102 days PI). Of the 209 naturally infected sera tested, from many zoos of State of Sao Paulo, 64.59 and 67.94% were positive in the IgG-IFA test and IgG-ELISA respectively. IgM-ELISA test detected seropositivity in 52.63% of the sera although IgM-IFA test detected it in only in 0.96% of the samples. The differential toxoplasmosis diagnosis was accomplished with Neospora caninum by IFA, observing 61 (29.2%) seropositive animals for this parasite and 149 (70.8%) negative. Sixty animals were positive for both T. gondii and N. caninum. Pneumonia, splenomegaly, and intestinal ulcers were macroscopically observed. Unremarkable interstitial pneumonia, enteritis, colitis, splenitis, and glomerulitis were microscopically observed. The immunohistochemical stain could not detect the presence of T. gondii in the tissues of the animals infected experimentally.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co-infection of Babesia spp. and Hepatozoon spp. was seen in 5 dogs. Sequenced samples revealed 100% identity with B. canis vogeli, and H. canis. This is the first molecular detection of H. canis in domestic dogs from Cuiabá. Additionally, it is described for the first time the presence of B. canis vogeli circulating among dogs in Cuiabá.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The present study is a report on the presence of Mycobacterium avium in four birds of the psittaciform order kept as pets. Anatomopathological diagnosis showed lesions suggestive of the agent and presence of alcohol-acid resistant bacilli (AARB) shown by the Ziehl-Neelsen staining. The identification of Mycobacterium avium was performed by means of PRA (PCR Restriction Analysis). DNA was directly extracted from tissue of the lesions and blocked in paraffin. The role of this agent in pet bird infection is discussed, as well as its zoonotic potential.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Nucleotide sequence analyses of the SH gene of 18 mumps virus isolates collected in the 2006-2007 parotitis epidemic in the state of São Paulo identified a new genotype, designated genotype M. This new designation fulfills all the parameters required to define a new mumps virus genotype. The parameters were established by an expert panel in collaboration with the World Health Organization (WHO) in 2005. This information will enhance the mumps virus surveillance program both at the national and global levels

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The protozoan parasites Giardia and Cryptosporidium have been described as important waterbone disease pathogens, and are associated with severe gastrointestinal illnesses. The objective of this paper was to investigate the presence of Giardia cysts and Cryptosporidium oocysts in sample from wtershed catchments and treated water sources. A total of 25 water samples were collected and examined according to the EPA - Method 1623, 2005, consisting of 12 from drinking water and 13 from raw water. Positive samples from raw water for Giardia cysts and Cryptosporidium oocysts were 46.1 and 7.6%, respectively. In finished water, positive samples were 41.7 per centfor Giardia cysts and 25 per cent for Cryptosporidium oocysts. Concentrations of Giardia cysts found in raw water samples ranged from "not detected" to 0.1oocysts/L, whereas concentrations of Cryptosporidium oocystsranged from "not detected" to 0.1 oocysts/L. In finished water, Giardia concentrations ranged from "not detected" to 0.06 cysts/L, and Cryptosporidium oocysts were not high in the samples analyzed. Nevertheless, the results of this study highlight the need to monitor these organisms in both raw and drinking water.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Aims: To determine the prevalence and expression of metallo-beta-lactamases (MBL)-encoding genes in Aeromonas species recovered from natural water reservoirs in southeastern Brazil. Methods and Results: Eighty-seven Aeromonas isolates belonging to Aeromonas hydrophila (n = 41) and Aer. jandaei (n = 46) species were tested for MBL production by the combined disk test using imipenem and meropenem disks as substrates and EDTA or thioglycolic acid as inhibitors. The presence of MBL genes was investigated by PCR and sequencing using new consensus primer pairs designed in this study. The cphA gene was found in 97.6% and 100% of Aer. hydrophila and Aer. jandaei isolates, respectively, whereas the acquired MBL genes bla(IMP), bla(VIM) and bla(SPM-1) were not detected. On the other hand, production of MBL activity was detectable in 87.8% and 10.9% of the cphA-positive Aer. hydrophila and Aer. jandaei isolates respectively. Conclusions: Our results indicate that cphA seems to be intrinsic in the environmental isolates of Aer. hydrophila and Aer. jandaei in southeastern Brazil, although, based on the combined disk test, not all of them are apparently able to express the enzymatic activity. Significance and Impact of the Study: These data confirm the presence of MBL-producing Aeromonas species in natural water reservoirs. Risk of water-borne diseases owing to domestic and industrial uses of freshwater should be re-examined from the increase of bacterial resistance point of view

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Homalodisca vitripennis ( Germar) ( Hemiptera: Cicadellidae), the glassy- winged sharpshooter, is one of the most important vectors of the bacterium, Xylella fastidiosa subsp. piercei ( Xanthomonadales: Xanthomonadaceae) that causes Pierce's Disease in grapevines in California. In the present study we report a new method for studying pathogen transmission or probing behavior of H. vitripennis. When confined, H. vitripennis attempt to probe the surface of sterile containers 48 hours post- acquisition of X. f. piercei. The saliva deposited during attempted feeding probes was found to contain X. f. piercei. We observed no correlation between X. f. piercei titers in the foregut of H. vitripennis that fed on Xylella- infected grapevines and the presence of this bacterium in the deposited saliva. The infection rate after a 48 h post- acquisition feeding on healthy citrus and grapevines was observed to be 77% for H. vitripennis that fed on grapevines and 81% for H. vitripennis that fed on citrus, with no difference in the number of positive probing sites from H. vitripennis that fed on either grapevine or citrus. This method is amenable for individual assessment of X. f. piercei- infectivity, with samples less likely to be affected by tissue contamination that is usually present in whole body extracts.