944 resultados para Codium fragile


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Dissertação de Mestrado, Ciências Biomédicas, 23 de Janeiro de 2015, Universidade dos Açores.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Habitat structure is known to influence the abundance of fishes on temperate reefs. Biotic interactions play a major role in determining the distribution and abundance of species. The significance of these forces in affecting the abundance of fishes may hinge on the presence of organisms that either create or alter habitat. On temperate reefs, for example, macroalgae are considered autogenic ecosystem engineers because they control resource availability to other species through their physical structure and provide much of the structure used by fish. On both coral and temperate reefs, small cryptic reef fishes may comprise up to half of the fish numbers and constitute a diverse community containing many specialized species. Small cryptic fishes (<100 mm total length) may be responsible for the passage of 57% of the energy flow and constitute ca. 35% of the overall reef fish biomass on coral reefs. These benthic fish exploit restricted habitats where food and shelter are obtained in, or in relation to, conditions of substrate complexity and/or restricted living space. A range of mechanisms has been proposed to account for the diversity and the abundance of small fishes: (1) lifehistory strategies that promote short generation times, (2) habitat associations and behaviour that reduce predation and (3) resource partitioning that allows small species to coexist with larger competitors. Despite their abundance and potential importance within reef systems, little is known of the community ecology of cryptic fishes. Specifically on habitat associations many theories suggested a not clear direction on this subject. My research contributes to the development of marine fish ecology by addressing the effects of habitat characteristics upon distribution of cryptobenthic fish assemblages. My focus was on the important shallow, coastal ecosystems that often serve as nursery habitat for many fish and where different type of habitat is likely to both play important roles in organism distribution and survival. My research included three related studies: (1) identification of structuring forces on cryptic fish assemblages, such as physical and biological forcing; (2) macroalgae as potential tools for cryptic fish and identification of different habitat feature that could explain cryptic fish assemblages distribution; (3) canopy formers loss: consequences on cryptic fish and relationship with benthos modifications. I found that: (1) cryptic fish assemblages differ between landward and seaward sides of coastal breakwaters in Adriatic Sea. These differences are explained by 50% of the habitat characteristics on two sides, mainly due to presence of the Codium fragile, sand and oyster assemblages. Microhabitat structure influence cryptic fish assemblages. (2) Different habitat support different cryptic fish assemblages. High heterogeneity on benthic assemblages reflect different fish assemblages. Biogenic components that explain different and diverse cryptic fish assemblages are: anemonia bed, mussel bed, macroalgal stands and Cystoseira barbata, as canopy formers. (3) Canopy forming loss is not relevant in structuring directly cryptic fish assemblages. A removal of canopy forming algae did not affect the structure of cryptic fish assemblages. Canopy formers algae on Conero cliff, does not seem to act as structuring force, probably due to its regressive status. In conclusion, cryptic fish have been shown to have species-specific associations with habitat features relating to the biological and non biological components afforded by fish. Canopy formers algae do not explain cryptic fish assemblages distribution and the results of this study and information from the literature (both from the Mediterranean Sea and elsewhere) show that there are no univocal responses of fish assemblages. Further exanimations on an non regressive status of Cystoseira canopy habitat are needed to define and evaluate the relationship between canopy formers and fish on Mediterranean sea.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

En partant d'une étude ethnographique dans un laboratoire engagés dans la conception et la réalisation de micro et nanosystèmes, l'article rend compte de la manière dont ces objets sont amenés à l'existence, mais aussi de la fragilité de cette existence d'être technologique. Confronté à de nombreux échecs, les chercheurs en viennent à douter de leur faisabilité technologique, de leur capacité à maintenir l'intérêt des industriels pour ces objets, voire même du sens de l' histoire technologique. Cette histoire, qu' ils croyaient évoluer inéluctablement des microsystèmes vers les nanosystèmes, semble brutalement s'arrêter, voir s'inverser. Les nanosystèmes ne seraient alors qu'un leurre, une illusion plutôt qu'une nouvelle catégorie de technologie. L'existence-même de l'objet est devenue problématique. En suivant les chercheurs, ingénieurs et techniciens au travail, l'article rend compte de la technogénèse comme exploration des modes d'existence des êtres technologiques.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Epilepsy is frequent in fragile X syndrome (FXS), the most common cause of inherited mental retardation. Status epilepticus (SE), however, seems exceptional in FXS, particularly as an initial epileptic manifestation. To our knowledge, SE was reported in only four FXS patients. We report the clinical features and electroencephalography (EEG) findings of five children with FXS, who presented with SE as their initial seizure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: Fragile X syndrome (FXS) is the most common inherited cause of intellectual disability. With no curative treatment available, current therapeutic approaches are aimed at symptom management. FXS is caused by silencing the FMR1 gene, which encodes FMRP; as loss of FMRP leads to the development of symptoms associated with FXS. Areas covered: In this evaluation, the authors examine the role of the metabotropic glutamate receptor 5 (mGluR5) in the pathophysiology of FXS, and its suitability as a target for rescuing the disease state. Furthermore, the authors review the evidence from preclinical studies of pharmacological interventions targeting mGluR5 in FXS. Lastly, the authors assess the findings from clinical studies in FXS, in particular the use of the Aberrant Behavior Checklist-Community Edition (ABC-C) and the recently developed ABC-C for FXS scale, as clinical endpoints to assess disease modification in this patient population. Expert opinion: There is cautious optimism for the successful treatment of the core behavioral and cognitive symptoms of FXS based on preclinical data in animal models and early studies in humans. However, the association between mGluR5-heightened responsiveness and the clinical phenotype in humans remains to be demonstrated. Many questions regarding the optimal treatment and outcome measures of FXS remain unanswered.