823 resultados para COMPETING EVENTS
Resumo:
Background: The complex natural history of human papillomavirus (HPV) infections following a single HPV test can be modeled as competing-risks events (i.e., no-, transient- or persistent infection) in a longitudinal setting. The covariates associated with these compet ng events have not been previously assessed using competing-risks regression models. Objectives: To gain further insights in the outcomes of cervical HPV infections, we used univariate- and multivariate competing-risks regression models to assess the covariaies associated with these competing events. Study Design and Methods: Covariates associated with three competing outcomes (no-, transient- or persistent HR-HPV infection) were analysed in a sub-cohort of 1,865 women prospectively followed-up in the NIS (n = 3,187) and LAMS Study (n = 12,114). Results: In multivariate competing-risks models (with two other outcomes as competing events), permanently HR-HPV negative outcome was significantly predicted only by the clearance of ASCUS+Pap during FU, while three independent covariates predicted transient HR-HPV infections: i) number of recent (< 12 months) sexual partners (risk increased), ii) previous Pap screening history (protective), and history of previous CIN (increased risk). The two most powerful predictors of persistent HR-HPV infections were persistent ASCUS+Pap (risk increased), and previous Pap screening history (protective). In pair-wise comparisons, number of recent sexual partners and previous CIN history increase the probability of transient HR-HPV infection against the HR-HPV negative competing event, while previous Pap screening history is protective. Persistent ASCUS+Pap during FU and no previous Pap screening history are significantly associated with the persistent HR-HPV outcome (compared both with i) always negative, and ii) transient events), whereas multiparity is protective. Conclusions: Different covariates are associated with the three main outcomes of cervical HPV infections. The most significant covariates of each competing events are probably distinct enough to enable constructing of a risk-profile for each main outcome.
Resumo:
OBJECTIVE: To analyse the effect of differentiation on disease-free survival (DFS) and overall survival (OS) in patients with stage I adenocarcinoma of the endometrium. PATIENTS AND METHODS: From 1979 to 1995, 350 patients with FIGO stage IA-IC with well (G1), moderately (G2) or poorly (G3) differentiated tumors were treated with surgery and high dose-rate brachytherapy with or without external radiation. Median age was 65 years (39-86 years). RESULTS: The 5-year DFS was 88+/-3% for the G1 tumors, 77+/-4% for the G2 tumors, and 67+/-7% for the G3 tumors (P=0.0049). With regard to the events contributing to DFS, the 5-year cumulative percentage of local relapse was 4.6% for the G1 tumors, 9.0% for the G2 tumors, and 4.6% (P=0.027) for the G3 tumors. Cumulative percentage of metastasis was 1.4, 6.3 and 7.2% (P<0.001), respectively, whereas percentages of death were 6.0, 7.9 and 20.7% (P<0.001). The 5-year OS was 91+/-3, 83+/-4 and 76+/-7%, respectively (P=0.0018). In terms of multivariate hazard ratios (HR), the relative differences between the three differentiation groups correspond to an increase of 77% of the risk of occurrence of either of the three events considered for the DFS (HR=1.77, 95% CI [0.94-3.33]), (P=0.078) for the G2 tumors and of 163% (HR=2.63, 95% CI [1.27-5.43]), (P=0.009) for the G3 tumors with respect to the G1 tumors. The estimated relative hazards for OS are, respectively, in line with those for DFS: HR=1.51 (P=0.282) for the G2 tumors; and HR=3.37 (P=0.003) for the G3 tumors. CONCLUSION: Patients with grade 1 tumors are those least exposed to either local relapse, metastasis, or death. In contrast patients with grade 2 tumors seem to be at higher risk of metastasis, whereas patients with grade 3 tumors appear at higher risk of death. Since we have looked at the first of three competing events (local relapse, metastasis and death), this suggests that patients with grade 3 tumors probably progress to death so fast that local relapse, if any, cannot be observed.
Resumo:
This study surveyed 32 athletes competing at a mixed martial arts (MMA) event held in Butte, Montana. The survey attempted to gather information regarding overall training volume, supplement use, volume change and specific exercises used. The survey return rate was 100 percent (32/32). Twenty-five of 32 athletes supplemented their training with strength training. Overall frequency of strength training ranged from one to six sessions/week, and overall frequency of fighting-specific training sessions/weel ranged from two to 10. Two of the 32 athletes used/had used anabolic-androgenic steroids. Sixteen MMA athletes performed exercises specifically for the neck musculature, and eight use the power clean within their strength-training program. Results suggested that strength and conditioning speciialists should educate the importance of, volume variation and periodization, balanced training, effective exercises, and the side effects of anabolic steroid use.
Resumo:
Exercising in the heat induces thermoregulatory and other physiological strain that can lead to impairments in endurance exercise capacity. The purpose of this consensus statement is to provide up-to-date recommendations to optimize performance during sporting activities undertaken in hot ambient conditions. The most important intervention one can adopt to reduce physiological strain and optimize performance is to heat acclimatize. Heat acclimatization should comprise repeated exercise-heat exposures over 1-2 weeks. In addition, athletes should initiate competition and training in a euhydrated state and minimize dehydration during exercise. Following the development of commercial cooling systems (e.g., cooling vest), athletes can implement cooling strategies to facilitate heat loss or increase heat storage capacity before training or competing in the heat. Moreover, event organizers should plan for large shaded areas, along with cooling and rehydration facilities, and schedule events in accordance with minimizing the health risks of athletes, especially in mass participation events and during the first hot days of the year. Following the recent examples of the 2008 Olympics and the 2014 FIFA World Cup, sport governing bodies should consider allowing additional (or longer) recovery periods between and during events for hydration and body cooling opportunities when competitions are held in the heat.
Resumo:
Exercising in the heat induces thermoregulatory and other physiological strain that can lead to impairments in endurance exercise capacity. The purpose of this consensus statement is to provide up-to-date recommendations to optimise performance during sporting activities undertaken in hot ambient conditions. The most important intervention one can adopt to reduce physiological strain and optimise performance is to heat acclimatise. Heat acclimatisation should comprise repeated exercise-heat exposures over 1-2 weeks. In addition, athletes should initiate competition and training in a euhydrated state and minimise dehydration during exercise. Following the development of commercial cooling systems (eg, cooling-vest), athletes can implement cooling strategies to facilitate heat loss or increase heat storage capacity before training or competing in the heat. Moreover, event organisers should plan for large shaded areas, along with cooling and rehydration facilities, and schedule events in accordance with minimising the health risks of athletes, especially in mass participation events and during the first hot days of the year. Following the recent examples of the 2008 Olympics and the 2014 FIFA World Cup, sport governing bodies should consider allowing additional (or longer) recovery periods between and during events, for hydration and body cooling opportunities, when competitions are held in the heat.
Resumo:
Background: Models of the maintenance of sex predict that one reproductive strategy, sexual or parthenogenetic, should outcompete the other. Distribution patterns may reflect the outcome of this competition as well as the effect of chance and historical events. We review the distribution data of sexual and parthenogenetic biotypes of the planarian Schmidtea polychroa. Results: S. polychroa lives in allopatry or sympatry across Europe except for Central and North-Western Europe, where sexual individuals have never been reported. A phylogenetic relationship between 36 populations based on a 385 bp fragment of the mitochondrial cytochrome oxidase I gene revealed that haplotypes were often similar over large geographic distances. In North Italian lakes, however, diversity was extreme, with sequence differences of up to 5% within the same lake in both sexuals and parthenogens. Mixed populations showed "endemic" parthenogenetic lineages that presumably originated from coexisting sexuals, and distantly related ones that probably result from colonization by parthenogens independent from sexuals. Conclusions: Parthenogens originated repeatedly from sexuals, mainly in Italy, but the same may apply to other Mediterranean regions (Spain, Greece). The degree of divergence between populations suggests that S. polychroa survived the ice ages in separate ice-free areas in Central, Eastern and Southern Europe and re-colonised Europe after the retreat of the major glaciers. Combining these results with those based on nuclear markers, the data suggest that repeated hybridisation between sexuals and parthenogenetic lineages in mixed populations maintains high levels of genetic diversity in parthenogens. This can explain why parthenogens persist in populations that were originally sexual. Exclusive parthenogenesis in central and western populations suggests better colonisation capacity, possibly because of inbreeding costs as well
Resumo:
Numerous studies have shown that attention is biased toward threatening events. More recent evidence has also found attentional biases for stimuli that are relevant to the current and temporary goals of an individual. We examined whether goal-relevant information still evokes an attentional bias when this information competes with threatening events. In three experiments, participants performed a dot probe task combined with a separate task that induced a temporary goal. The results of Experiment 1 showed that attention was oriented to goal-relevant pictures in the dot probe task when these pictures were simultaneously presented with neutral or threatening pictures. Whether goal-relevant pictures themselves were threatening or neutral did not influence the results. Experiment 2 replicated these findings in a sample of highly trait-anxious participants. Experiment 3 showed that attention was automatically deployed to stimuli relevant to a temporary goal even in the presence of stimuli that signal imminent and genuine threat (i.e., a colored patch signaling the presentation of an aversive noise). These findings further corroborate the conclusion that an individual's current and temporary goals guide early attentional processes
Resumo:
Background: In addition to the oncogenic human papillomavirus (HPV), several cofactors are needed in cervical carcinogenesis, but whether the HPV covariates associated with incident i) CIN1 are different from those of incident ii) CIN2 and iii) CIN3 needs further assessment. Objectives: To gain further insights into the true biological differences between CIN1, CIN2 and CIN3, we assessed HPV covariates associated with incident CIN1, CIN2, and CIN3. Study Design and Methods: HPV covariates associated with progression to CIN1, CIN2 and CIN3 were analysed in the combined cohort of the NIS (n = 3,187) and LAMS study (n = 12,114), using competing-risks regression models (in panel data) for baseline HR-HPV-positive women (n = 1,105), who represent a sub-cohort of all 1,865 women prospectively followed-up in these two studies. Results: Altogether, 90 (4.8%), 39 (2.1%) and 14 (1.4%) cases progressed to CIN1, CIN2, and CIN3, respectively. Among these baseline HR-HPV-positive women, the risk profiles of incident GIN I, CIN2 and CIN3 were unique in that completely different HPV covariates were associated with progression to CIN1, CIN2 and CIN3, irrespective which categories (non-progression, CIN1, CIN2, CIN3 or all) were used as competing-risks events in univariate and multivariate models. Conclusions: These data confirm our previous analysis based on multinomial regression models implicating that distinct covariates of HR-HPV are associated with progression to CIN1, CIN2 and CIN3. This emphasises true biological differences between the three grades of GIN, which revisits the concept of combining CIN2 with CIN3 or with CIN1 in histological classification or used as a common end-point, e.g., in HPV vaccine trials.
Resumo:
Influenza A virus assembly is an unclear process, whereby individual virion components form an infectious particle. The segmented nature of the influenza A genome imposes a problem to assembly because it requires packaging of eight distinct RNA particles (vRNPs). It also allows genome mixing from distinct parental strains, events associated with influenza pandemic outbreaks. It is important to public health to understand how segmented genomes assemble, a process that is dependent on the transport of components to assembly sites. Previously, it has been shown that vRNPs are carried by recycling endosome vesicles, resulting in a change of Rab11 distribution. Here, we describe that vRNP binding to recycling endosomes impairs recycling endosome function, by competing for Rab11 binding with family-interacting proteins, and that there is a causal relationship between Rab11 ability to recruit family-interacting proteins and Rab11 redistribution. This competition reduces recycling sorting at an unclear step, resulting in clustering of single- and double-membraned vesicles. These morphological changes in Rab11 membranes are indicative of alterations in protein and lipid homeostasis during infection. Vesicular clustering creates hotspots of the vRNPs that need to interact to form an infectious particle.
Resumo:
The aim of this paper was to summarise the reported excess in coronary events on Mondays, and examine the evidence for three competing explanations: stress, alcohol consumption, or registration errors. A review of the literature found 28 studies covering 16 countries and over 1.6 million coronary events. The overall Monday excess was small; in a population experiencing 100 coronary events per week there was one more event on Monday than other days. The excess was larger in men and in studies including sudden cardiac death or cardiac arrests. In a prospective study an increase in events on Mondays was associated with greater alcohol consumption, lower rainfall, and the month of January. The excess in coronary events on Mondays is a persistent phenomenon. The size of the effect varies widely between populations. There is some evidence of an association with alcohol consumption, but a definitive explanation remains elusive and is likely to remain so because of the smallness of the effect and the paucity of high quality data.
Resumo:
Our PhD study focuses on the role of aspectual marking in expressing simultaneity of events in Tunisian Arabic as a first language, French as a first language, as well as in French as a second language by Tunisian learners at different acquisitional stages. We examine how the explicit markers of on-goingness qa:’id and «en train de» in Tunisian Arabic and in French respectively are used to express this temporal relation, in competition with the simple forms, the prefixed verb form in Tunisian Arabic and the présent de l’indicatif in French. We use a complex verbal task of retelling simultaneous events sharing an interval on the time axis based on eight videos presenting two situations happening in parallel. Two types of simultaneity are exploited: perfect simultaneity (when the two situations are parallel to each other) and inclusion (one situation is framed by the second one). Our informants in French and in Tunisian Arabic have two profiles, highly educated and low educated speakers. We show that the participants’ response to the retelling task varies according to their profiles, and so does their use of the on-goingness devices in the expression of simultaneity. The differences observed between the two profile groups are explained by the degree to which the speakers have developed a habit of responding to tasks. This is a skill typically acquired during schooling. We notice overall that the use of qa:’id as well as of «en train de» is less frequent in the data than the use of the simple forms. However, qa:’id as well as «en train de» are employed to play discursive roles that go beyond the proposition level. We postulate that despite the shared features between Tunisian Arabic and French regarding marking the concept of on-goingness, namely the presence of explicit lexical, not fully grammaticalised markers competing with other non-marked forms, the way they are used in the discourse of simultaneous events shows clear differences. We explain that «en train de» plays a more contrastive role than qa:’id and its use in discourse obeys a stricter rule. In cases of the inclusion type of simultaneity, it is used to construe the ‘framing’ event that encloses the second event. In construing perfectly simultaneneous events, and when both «en train de» and présent de l’indicatif are used, the proposition with «en train de» generally precedes the proposition with présent de l’indicatif, and not the other way around. qa:id obeys, but to a less strict rule as it can be used interchangeably with the simple form regardless of the order of propositions. The contrastive analysis of French L1 and L2 reveals learners’ deviations from natives’ use of on-goingness devices. They generalise the use of «en train de» and apply different rules to the interaction of the different marked and unmarked forms in discourse. Learners do not master its role in discourse even at advanced stages of acquisition despite its possible emergence around the basic and intermediate varieties. We conclude that the native speakers’ use of «en train de» involves mastering its role at the macro-structure level. This feature, not explicitly available to learners in the input, might persistently present a challenge to L2 acquisition of the periphrasis.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.