La Région Méditerranéenne en 2020 et son Rôle dans le Réseau Energétjgue Européen, Vol. II: Les bilans energetiques de synthese des PSEM et des pays du CCG, Historique 1971 - 1980 - 1991 puis scénarios projectif et alternatif horizons 2000 - 2010 - 2020. Juin 1994 = The Mediterranean region in 2020 and its Role in European Energétjgue Network, Vol. II: The energy balances of synthesis SEMC and the GCC countries, History 1971 - 1980 - 1991 and projective and alternative scenarios years 2000 - 2010 - to 2020. June 1994

None.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Efeito da eletrolipólise na gordura abdominal em doentes cardíacos - fase manutenção

Objetivo: Verificar se a eletrolipólise pode ser um método coadjuvante na Reabilitação Cardíaca (RC) de modo a diminuir a gordura abdominal em indivíduos com Doença Cardiovascular (DCV). Métodos: Seis indivíduos, de ambos os sexos, da classe de RC do Centro Clinico de Gaia (CCG), foram distribuídos aleatoriamente em dois grupos, grupo controlo (GC) (n=3) e grupo experimental (GE) (n=3). O GE realizou 8 sessões (duas vezes por semana) de eletrolipólise por microcorrentes 30 minutos antes da classe de RC. Utilizaram-se como meios de avaliação a perimetria, adipometria, bioimpedância e ultrassonografia, análise sanguíneas, bem como a aplicação da Hospital Anxiety and Depression Scale (HADS), Questionário Internacional de Actividade Física (IPAQ) e Questionário Semi-Quantitativo de Frequência Alimentar (QSQFA). Resultados: Através do cálculo da mudança mínima detetável (MMD) verificou-se diminuição do perímetro ao nível do umbigo (3,7cm e 1,5cm) e barriga (4,2cm e 2,83cm) em dois indivíduos do GE e diminuição nas avaliações da ultrassonografia (de 1,3mm a 8,4mm) no GE. Conclusão: Do presente estudo foi possível concluir que nesta amostra existiu uma tendência para a diminuição da gordura abdominal localizada através dos dados obtidos pela perimetria e ultrassonografia.

Measuring end-to-end delay in real-time auralisation systems

One of the major challenges in the development of an immersive system is handling the delay between the tracking of the user’s head position and the updated projection of a 3D image or auralised sound, also called end-to-end delay. Excessive end-to-end delay can result in the general decrement of the “feeling of presence”, the occurrence of motion sickness and poor performance in perception-action tasks. These latencies must be known in order to provide insights on the technological (hardware/software optimization) or psychophysical (recalibration sessions) strategies to deal with them. Our goal was to develop a new measurement method of end-to-end delay that is both precise and easily replicated. We used a Head and Torso simulator (HATS) as an auditory signal sensor, a fast response photo-sensor to detect a visual stimulus response from a Motion Capture System, and a voltage input trigger as real-time event. The HATS was mounted in a turntable which allowed us to precisely change the 3D sound relative to the head position. When the virtual sound source was at 90º azimuth, the correspondent HRTF would set all the intensity values to zero, at the same time a trigger would register the real-time event of turning the HATS 90º azimuth. Furthermore, with the HATS turned 90º to the left, the motion capture marker visualization would fell exactly in the photo-sensor receptor. This method allowed us to precisely measure the delay from tracking to displaying. Moreover, our results show that the method of tracking, its tracking frequency, and the rendering of the sound reflections are the main predictors of end-to-end delay.

Seguimento de dois anos em pacientes com hipertensão arterial pulmonar sob tratamento com sildenafila

FUNDAMENTO: Os efeitos de longo prazo das drogas desenvolvidas para o controle da hipertensão arterial pulmonar (HAP) são pouco conhecidos, já que os estudos multicêntricos em geral têm duração de 12 a 16 semanas. OBJETIVO: Avaliar a evolução de dois anos, em pacientes com HAP submetidos à monoterapia com sildenafila (inibidor da fosfodiesterase-5), com respeito à capacidade funcional. MÉTODOS: Vinte e quatro pacientes (idade entre 8 e 54 anos) com HAP idiopática (HAPI, n = 9) ou associada a cardiopatias congênitas (HAP-CCg, n = 15) foram tratados com sildenafila por dois anos, com doses diárias que variaram de 60 a 225 mg (três tomadas), por via oral. A capacidade física foi avaliada pela distância caminhada no teste de 6 minutos (DC6M) e pelo grau de dispneia ao final da caminhada (escala de Borg), sendo também registrada a saturação periférica de oxigênio (SpO(2)6M, oximetria de pulso). RESULTADOS: Nos 18 pacientes que completaram dois anos de seguimento, houve incremento progressivo e sustentado na DC6M, tanto no grupo HAPI (de 239 ± 160 m para 471 ± 66 m, p = 0,0076) como no grupo HAP-CCg (de 361 ± 144 m para 445 ± 96m, p = 0,0031), com melhora da dispneia ao final da caminhada (p < 0,05 em ambos). Não houve decréscimo na SpO(2)6M nos grupos considerados; em particular, pacientes com HAP-CCg evoluíram de 77 ± 20% para 79 ± 16% (p = 0,5248). Houve 5 óbitos (três no grupo HAPI) e uma perda de seguimento no período. CONCLUSÃO: Em dois anos de seguimento, a sildenafila mostrou-se útil no controle da condição funcional de pacientes com HAP, com melhora significante nas duas etiologias consideradas.

Preferential binding of the methyl-CpG binding domain protein 2 at methylated transcriptional start site regions.

Methyl-CpG Binding Domain (MBD) proteins are thought to be key molecules in the interpretation of DNA methylation signals leading to gene silencing through recruitment of chromatin remodeling complexes. In cancer, the MBD-family member, MBD2, may be primarily involved in the repression of genes exhibiting methylated CpG at their 5' end. Here we ask whether MBD2 randomly associates methylated sequences, producing chance effects on transcription, or exhibits a more specific recognition of some methylated regions. Using chromatin and DNA immunoprecipitation, we analyzed MBD2 and RNA polymerase II deposition and DNA methylation in HeLa cells on arrays representing 25,500 promoter regions. This first whole-genome mapping revealed the preferential localization of MBD2 near transcription start sites (TSSs), within the region analyzed, 7.5 kb upstream through 2.45 kb downstream of 5' transcription start sites. Probe by probe analysis correlated MBD2 deposition and DNA methylation. Motif analysis did not reveal specific sequence motifs; however, CCG and CGC sequences seem to be overrepresented. Nonrandom association (multiple correspondence analysis, p < 0.0001) between silent genes, DNA methylation and MBD2 binding was observed. The association between MBD2 binding and transcriptional repression weakened as the distance between binding site and TSS increased, suggesting that MBD2 represses transcriptional initiation. This hypothesis may represent a functional explanation for the preferential binding of MBD2 at methyl-CpG in TSS regions.

Biomarcadors oculars en la malaltia d’Alzheimer precoç: Estudi de la capa de fibres nervioses i cèl•lules ganglionars de la retina i alteracions pupil•lars.

Actualment, no existeix un diagnòstic de certesa in vivo per la malaltia d’Alzheimer (MA), i l’ull podria aportar biomarcadors de la malaltia. 15 pacients amb MA i 15 controls es van sotmetre a un test d’hipersensibilitat a la pilocarpina i a OCT de capa de fibres nervioses (CFNR) i de cèl•lules ganglionars retinianes (CCG). Es trobà major hipersensibilitat a la pilocarpina i major gruix de la CCG en el grup de pacients. També una tendència a l’aprimament de la CFNR en estadis avançats de la MA. Aquestes proves representen un camí esperançador per trobar un test diagnòstic de la MA.

Functional studies of a germ-line polymorphism at codon 47 within the p53 gene.

A rare germ-line polymorphism in codon 47 of the p53 gene replaces the wild-type proline (CCG) with a serine (TCG). Restriction analysis of 101 human samples revealed the frequency of the rare allele to be 0% (n = 69) in Caucasians and 4.7% (3/64, n = 32) among African-Americans. To investigate the consequence of this amino acid substitution, a cDNA construct (p53 mut47ser) containing the mutation was introduced into a lung adenocarcinoma cell line (Calu-6) that does not express p53. A growth suppression similar to that obtained after introduction of a wild-type p53 cDNA construct was observed, in contrast to the result obtained by introduction of p53 mut143ala. Furthermore, expression of neither p53 mut47ser nor wild-type p53 was tolerated by growing cells. In transient expression assays, both mut47ser and wild-type p53 activated the expression of a reporter gene linked to a p53 binding sequence (PG13-CAT) and inhibited the expression of the luciferase gene under the control of the Rous sarcoma virus promoter (RSVluc). In the same assay, mut143ala did not activate the expression of PG13-CAT and produced only a slight inhibitory effect on RSVluc. These findings indicate that the p53 variant with a serine at codon 47 should be considered as a rare germ-line polymorphism that does not alter the growth-suppression activity of p53.

Una lectura crítica sobre la política de participación ciudadana promovida por el gobierno de Álvaro Uribe Vélez. Caso de estudio: los Consejos Comunales de Gobierno. Periodo de estudio: 2002-2010.

Uno de los objetivos perseguidos en los Consejos Comunales de Gobierno, celebrados por la administración de Álvaro Uribe Vélez en Colombia (2002-2010), fue la promoción de la participación ciudadana. Partiendo de la ambigüedad de lo que este objetivo puede significar o perseguir, nos propusimos hacer una revisión inicial de estudios que han analizado y avanzado en la teorización de diversos ejercicios de participación ciudadana en Colombia y en el mundo, así como del concepto de ciudadanía activa, el cual ha sido desarrollado por diversas tradiciones de pensamiento en contextos diversos, incluidos los escenarios de participación ciudadana. Para el análisis de los Consejos Comunales de Gobierno -ejemplo del tipo de participación que se promovió por el gobierno de Álvaro Uribe Vélez-, nos concentramos en tres aspectos: una exposición general de la institucionalidad desarrollada para la participación ciudadana en Colombia; la caracterización del gobierno bajo el que se promovieron estos consejos; y el análisis del diseño institucional particular a estos. Teniendo en cuenta el carácter de la política de participación impulsada por el gobierno de Álvaro Uribe Vélez, la tradición institucional para la participación en Colombia, y el particular desarrollo de éstos consejos, se formulan al final unas reflexiones y recomendaciones con respecto a las iniciativas de gobierno para la participación ciudadana.

Análisis de las organizaciones de integración económica como mecanismo de estabilidad regional, aplicado al caso del Consejo de Cooperación del Golfo (2003-2011)

El Consejo de Cooperación del Golfo (CCG) se estableció como una organización internacional gubernamental a nivel regional fundada en bases de desarrollo económico, pero gracias a los riesgos que generan inestabilidad en la región, cambio su objetivo, logrando una evolución en el eje de seguridad y defensa.

Cambios maculares y de capa de fibras nerviosas ganglionares posterior a la vitrectomía pars plana y sus factores pronósticos en la fundación oftalmológica nacional

OBJETIVOS: Determinar los factores pronóstico, cambios maculares morfológicos y de capa de fibras nerviosas ganglionares posterior a vitrectomía pars plana, en la Fundación Oftalmológica Nacional. MATERIALES Y MÉTODOS: Estudio longitudinal de antes y después (3y6 meses) de la vitrectomía pars plana (VPP) en pacientes con membrana epirretiniana, agujero macular, síndrome de tracción vítreo macular y opacidades vítreas no-inflamatorias. Se realizó seguimiento clínico y con tomografía de coherencia óptica. RESULTADOS: Grupo de 60 pacientes (mujeres 65.0%), edad promedio 65.45+9.49años y tiempo de enfermedad promedio 23+29.79meses. Las indicaciones de VPP (n=60ojos) fueron agujero macular (38.3%) y membrana epirretiniana (36.7%). Se encontró diferencia significativa entre grosor del complejo capa de células ganglionares (CCG)+capa plexiforme interna (CPI) inicial y 3 meses (p=0.039), correlación entre grosor del complejo CCG+CPI al tercer y sexto mes (r=0.704,p<0.001) y grosor del complejo CCG+CPI al tercer mes con grosor foveal central (CFT) al tercer y sexto mes (r=–0.594,p<0.001 y r=–0.595,p=0.001). Mayores de 65años tenían menor grosor de CFNG a 6meses (r=-0.528,p=0.007). El grosor de CFNG promedio y la presencia de la zona elipsoide inicial fueron factores pronósticos de buena agudeza visual al tercer mes de VPP (r2=0.414,p=0.018, y r2=0.414,p=0.010). CONCLUSIÓN: El grosor de CFNG y la presencia de la zona elipsoide inicial tienen alta capacidad predictiva de buena agudeza visual al tercer mes de VPP, y, correlación inversa entre grosor del complejo CCG+CPI con CFT al tercer y sexto mes de VPP.

Estudos de microsatélites em humanos: aplicações na identificação de indivíduos, genética de populações, datação de mutações e diagnóstico de doenças

Os microsatélites, também chamados STRs (Short Tandem Repeat), são pequenas sequências de DNA que consistem numa sequência de repetições de um motivo que varia de um a seis pares de bases. Existem em quase todos os cromossomas humanos e podem situar-se nos exões ou nos intrões. Estes últimos são altamente polimórficos e são por isso utilizados na identificação de indivíduos em testes de paternidade e também em estudos de genética de populações. A combinação dos vários genótipos possíveis faz com que cada indivíduo possua um perfil único, que permite a sua identificação. Existem também microsatélites associados a exões ou a regiões promotoras dos genes, normalmente repetições trinucleotídicas CGG/CCG ou CAG/CTG, associados a doenças neurodegenerativas como a síndrome do X-frágil e a doença de Huntington. Neste trabalho caracterizaram-se geneticamente várias populações humanas dos arquipélagos da Madeira, Açores e Cabo Verde. A partir do estudo dos microsatélites do cromossoma Y, foram definidas idades de coalescência que permitiram concluir que as cópias do gene DAZ situado no cromossoma Y são o resultado de um processo evolutivo estando a sua evolução associada a alguns haplogrupos. Verificou-se também a ocorrência de possíveis mutações nos SNPs que definem os haplogrupos, através da comparação dos microsatélites do cromossoma Y dentro de cada haplogrupo, especialmente no haplogrupo E3b. Verificou-se existir uma associação entre o número de repetições CAG e GGC do gene Receptor de Androgénios (AR), situado no cromossoma X, e a infertilidade especialmente quando combinados os dois polimorfismos, parecendo haver um efeito protector dos alelos maiores e alguma susceptibilidade para os alelos menores. Quando se estudou o número de repetições GGC do gene FMR1 em doentes com suspeita de síndrome de X-frágil observaram-se diferenças significativas quando comparadas com a população em geral e com um grupo de sobredotados. Essa diferença deveu-se principalmente à presença do alelo 29 em quase todos os indivíduos do primeiro grupo o que por si só não constitui um factor de risco mas poderá ser uma indicação da associação deste alelo com outra mutação no mesmo gene que possa ser responsável por este fenótipo.

Satellyptus: analysis and database of microsatellites from ESTs of Eucalyptus

The main goal of our research was to search for SSRs in the Eucalyptus EST FORESTs database (using a software for mining SSR-motifs). With this objective, we created a database for cataloging Eucalyptus EST-derived SSRs, and developed a bioinformatics tool, named Satellyptus, for finding and analyzing microsatellites in the Eucalyptus EST database. The search for microsatellites in the FORESTs database containing 71,115 Eucalyptus EST sequences (52.09 Mb) revealed 20,530 SSRs in 15,621 ESTs. The SSR abundance detected on the Eucalyptus ESTs database (29% or one microsatellite every four sequences) is considered very high for plants. Amongst the categories of SSR motifs, the dimeric (37%) and trimeric ones (33%) predominated. The AG/CT motif was the most frequent (35.15%) followed by the trimeric CCG/CGG (12.81%). From a random sample of 1,217 sequences, 343 microsatellites in 265 SSR-containing sequences were identified. Approximately 48% of these ESTs containing microsatellites were homologous to proteins with known biological function. Most of the microsatellites detected in Eucalyptus ESTs were positioned at either the 5 or 3 end. Our next priority involves the design of flanking primers for codominant SSR loci, which could lead to the development of a set of microsatellite-based markers suitable for marker-assisted Eucalyptus breeding programs.