990 resultados para Breeding methods
Resumo:
In absence of basic canine hip biomechanics, a specific, consequent three dimensional concept to evaluate the coxofemoral joint was developed for the dog. With the help of a new method to radiologically demonstrate the hip in a physiological standing position several new clinically relevant aspects could be further investigated. For example the breed specific anatomical differences in the hip, and dynamics and the background on "iatrogenic luxations" in HD diagnostics could be shown. The caudal luxation and the growth abnormalities of the hip and their consequences on the whole leg (antetorsion syndrome) as a consequence of inadequate breeding could be demonstrated.
Resumo:
Mode of access: Internet.
Resumo:
Ascochyta blight, caused by Ascochyta lentis , is one of the most globally important diseases of lentil. Breeding for host resistance has been suggested as an efficient means to control this disease. This paper summarizes existing studies of the characteristics and control of Ascochyta blight in lentil, genetics of resistance to Ascochyta blight and genetic variations among pathogen populations (isolates). Breeding methods for control of the disease are discussed. Six pathotypes of A. lentis have been reported. Many resistant cultivars/lines have been identified in both cultivated and wild lentil. Resistance to Ascochyta blight in lentil is mainly under the control of major genes, but minor genes also play a role. Current breeding programmes are based on crossing resistant and high-yielding cultivars and multilocation testing. Gene pyramiding, exploring slow blighting and partial resistance, and using genes present in wild relatives will be the methods used in the future. Identification of more sources of resistance genes, good characterization of the host-pathogen system, and identification of molecular markers tightly linked to resistance genes are suggested as the key areas for future study.
Resumo:
Plant breeders use many different breeding methods to develop superior cultivars. However, it is difficult, cumbersome, and expensive to evaluate the performance of a breeding method or to compare the efficiencies of different breeding methods within an ongoing breeding program. To facilitate comparisons, we developed a QU-GENE module called QuCim that can simulate a large number of breeding strategies for self-pollinated species. The wheat breeding strategy Selected Bulk used by CIMMYT's wheat breeding program was defined in QuCim as an example of how this is done. This selection method was simulated in QuCim to investigate the effects of deviations from the additive genetic model, in the form of dominance and epistasis, on selection outcomes. The simulation results indicate that the partial dominance model does not greatly influence genetic advance compared with the pure additive model. Genetic advance in genetic systems with overdominance and epistasis are slower than when gene effects are purely additive or partially dominant. The additive gene effect is an appropriate indicator of the change in gene frequency following selection when epistasis is absent. In the absence of epistasis, the additive variance decreases rapidly with selection. However, after several cycles of selection it remains relatively fixed when epistasis is present. The variance from partial dominance is relatively small and therefore hard to detect by the covariance among half sibs and the covariance among full sibs. The dominance variance from the overdominance model can be identified successfully, but it does not change significantly, which confirms that overdominance cannot be utilized by an inbred breeding program. QuCim is an effective tool to compare selection strategies and to validate some theories in quantitative genetics.
Resumo:
Genetic improvement of common bean nutritional quality has advantages in marketing and can contribute to society as a food source. The objective of this study was to evaluate the genetic variability for grain yield, calcium and iron concentrations in grains of inbred common bean lines obtained by different breeding methods. For this, 136 F7 inbred lines were obtained using the Pedigree method and 136 F7 inbred lines were obtained using the Single-Seed Descent (SSD) method. The lines showed genetic variability for grain yield, and concentrations of calcium and iron independently of the method of advancing segregating populations. The Pedigree method allows obtaining a greater number of lines with high grain yield. Selection using the SSD method allows the identification of a larger number of lines with high concentrations of calcium and iron in grains. Weak negative correlations were found between grain yield and calcium concentration (r = -0.0994) and grain yield and iron concentration (r = -0.3926). Several lines show genetic superiority for grain yield and concentrations of calcium and iron in grains and their selection can result in new common bean cultivars with high nutritional quality.
Resumo:
There is a significant potential to improve the plant-beneficial effects of root-colonizing pseudomonads by breeding wheat genotypes with a greater capacity to sustain interactions with these bacteria. However, the interaction between pseudomonads and crop plants at the cultivar level, as well as the conditions which favor the accumulation of beneficial microorganisms in the wheat rhizosphere, is largely unknown. Therefore, we characterized the three Swiss winter wheat (Triticum aestivum) cultivars Arina, Zinal, and Cimetta for their ability to accumulate naturally occurring plant-beneficial pseudomonads in the rhizosphere. Cultivar performance was measured also by the ability to select for specific genotypes of 2,4-diacetylphloroglucinol (DAPG) producers in two different soils. Cultivar-specific differences were found; however, these were strongly influenced by the soil type. Denaturing gradient gel electrophoresis (DGGE) analysis of fragments of the DAPG biosynthetic gene phlD amplified from natural Pseudomonas rhizosphere populations revealed that phlD diversity substantially varied between the two soils and that there was a cultivar-specific accumulation of certain phlD genotypes in one soil but not in the other. Furthermore, the three cultivars were tested for their ability to benefit from Pseudomonas inoculants. Interestingly, Arina, which was best protected against Pythium ultimum infection by inoculation with Pseudomonas fluorescens biocontrol strain CHA0, was the cultivar which profited the least from the bacterial inoculant in terms of plant growth promotion in the absence of the pathogen. Knowledge gained of the interactions between wheat cultivars, beneficial pseudomonads, and soil types allows us to optimize cultivar-soil combinations for the promotion of growth through beneficial pseudomonads. Additionally, this information can be implemented by breeders into a new and unique breeding strategy for low-input and organic conditions.
Resumo:
The yearly genetic progress obtained by breeding for increased soybean yield has been considered acceptable worldwide. It is common sense, however, that this progress can be improved further if refined breeding techniques, developed from the knowledge of the genetic mechanisms controlling soybean yield, are used. In this paper, data from four cultivars and/or lines and their derived sets of F2, F3, F7, F8, F9 and F10 generations assayed in 17 environments were analyzed to allow an insight of the genetic control of soybean yield under different environmental conditions. The general picture was of a complex polygene system controlling yield in soybeans. Additive genetic effects predominated although dominance was often found to be significant. Complications such as epistasis, linkage and macro and micro genotype x environment (G x E) interactions were also commonly detected. The overall heritability was 0.29. The relative magnitude of the additive effects and the complicating factors allowed the inference that the latter are not a serious problem to the breeder. The low heritability values and the considerable magnitude of G x E interactions for yield, however, indicated that careful evaluation through experiments designed to allow for the presence of these effects is necessary for successful selection.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Random amplified polymorphic DNA markers (RAPD) were used to estimate the variability of 14 genotypes of Brazilian wheat (Triticum aestivum L.), using a set of 50 random 10mer primers. A total of 256 reproducibly scorable DNA amplification products were obtained from 48 of the primers, 83% of which were polymorphic. Genetic distances among genotypes were calculated and a dendrogram and a principal coordinates analysis showing the genetic relationships among them were obtained. Despite the low variability found (average genetic distance of 27%), two groups of genotypes could be identified, which probably reflect how they were formed. Studies such as this one may be important in the planning and development of future improvement programs for this plant species.
Resumo:
Seed from the sensitive wheat (Triticum aestivumL.) cultivar Anahuac was treated to gamma-ray irradiation and eleven Al3+ tolerant mutants selected. The objective was to compare these mutants to the original Anahuac and to the tolerant wheat cultivars IAC-24 and IAC-60 from 1994 to 1996 in acid (Capão Bonito) and limed (Monte Alegre do Sul) soil field trials, in the State of São Paulo, Brazil. Grain yield and agronomic characteristics were analyzed. All the mutant lines yielded higher than the sensitive Anahuac cultivar in the acid soils of Capão Bonito. Under limed soil conditions, 10 mutants had a similar yield to the original sensitive cultivar and one a lower yield. The majority of the mutants were similar in yield to the tolerant cultivars IAC-24 and IAC-60 under both conditions. Some of the mutants showed altered agronomic characteristics, but these alterations did not generally influence the grain yield. The results indicated that tolerant lines with good characteristics may be obtained from a susceptible cultivar by mutation induction, thus allowing cropping under conditions where Al3 + is a limiting factor.
Resumo:
Pinus caribaea var. hondurensis (Sénécl) Barr. & Golf. is a tropical pine that naturally occurs in lowland areas of Belize, El Salvador, Guatemala, Honduras, Nicaragua, and eastern Mexico. It has been one of the most studied tropical pines and the one with the most commercial importance in Brazil. The objective of this work was to select the best provenances for plantations and best trees in families for the establishment of seed orchards. For that a trial with five provenances and 47 open-pollinated families was planted near Planaltina, Federal District, in the Cerrado Region of Brazil. The provenances tested were Poptun (Guatemala), Gualjoco, Los Limones, El Porvenir and Santa Cruz de Yojoa (Honduras) and assessed at 12 years of age. Poptun and Gualjoco had larger volume, and Los Limones and El Porvenir the lowest incidence of forks and foxtails. Individual tree heritabilities for volume, stem form and branch diameter were 0.34, 0.06, and 0.26 respectively. More than 90% of the trees had defects, common in unimproved P. caribaea. Selection criteria for quality traits need to be relaxed in the first generation of breeding to allow for larger genetic gains in productivity. Results from this test compared with P. caribaea var. hondurensis trials in other Brazilian, Colombian and Venezuelan sites suggest that provenance x site and family x site interactions are not as strong as in other pine species.
Resumo:
Genetic progress depends on germplasm quality and breeding methods. Twelve maize populations and their crosses were evaluated to estimate combining ability and potential to be included as source populations in breeding programs. Plant height, point of insertion of the first ear, number of ears per plant, number of grains per ear, root and stalk lodging and grain yield were studied in two locations in Brazil, during the 1997/98 season. Genotype sum of squares was divided into general (GCA) and specific (SCA) combining ability. Results indicated the existence of genetic divergence for all traits analyzed, where additive effects were predominant. The high heterosis levels observed, mainly in Xanxerê, suggested the environmental influence on the manifestation of this genetic phenomenon. Populations revealed potential to be used in breeding programs; however, those more intensively submitted to selection could provide larger genetic progress, showing the importance of population improvement for the increment of the heterosis in maize.
Resumo:
The development and optimization of efficient transformation protocols is essential in new citrus breeding programs, not only for rootstock, but also for scion improvement. Transgenic 'Hamlin' sweet orange (Citrus sinensis (L.) Osbeck) plants were obtained by Agrobacterium tumefaciens-mediated transformation of epicotyl segments collected from seedlings germinated in vitro. Factors influencing genetic transformation efficiency were evaluated including seedling incubation conditions, time of inoculation with Agrobacterium and co-culture conditions. Epicotyl segments were adequate explants for transformation, regenerating plants by direct organogenesis. Higher percentage of transformation was obtained with explants collected from seedlings germinated in darkness, transferred to 16 hours photoperiod for 2-3 weeks, and inoculated with Agrobacterium for 15-45 min. The best co-culture condition was the incubation of the explants in darkness, for three days in culture medium supplemented with 100 muM of acetosyringone. Genetic transformation was confirmed by performing beta-glucoronidase (GUS) assays and, subsequently, by PCR amplification for the nptII and GUS genes.
Resumo:
The objective of this work was to characterize mandarin (Citrus spp.) germplasm from Southern Brazil by morphological and molecular analyses. Thirty seven cultivars from 34 distinct mandarin varieties were evaluated by morphological and agronomic traits of leaves, flowers and fruits, and by microsatellite markers. The morphological and agronomic characteristics suggested that almost all varieties can be produced for commercial use, and some, as the Satsuma variety, are recommended for breeding programs. Pooled DNA samples from 1-5 plants belonging to each cultivar were tested. Eight of the nine primers detected polymorphisms. Specific markers were found for some accessions. The dendrogram constructed with the morphological results divided the 37 cultivars into four groups, while that obtained with the microsatellites clustered 35 of the 37 cultivars into three groups only. Generally, intervarietal differences are not high, and this lack of agreement in the two multifactorial analyses indicates that diverse evolutionary factors are acting at these two levels of investigation.