Synthesis of liquid crystalline benzothiazole base derivatives: A study of their optical and electrical properties

Two new donor-acceptor type liquid crystalline semiconductors based on benzothiazole have been synthesized. Their structural, photophysical and electronic properties were investigated using X-ray diffraction, atomic force microscopy, cyclic voltammetry, UV-Vis, photoluminescence, and Raman spectroscopy. The liquid crystalline behaviour of the molecules was thoroughly examined by differential scanning calorimetry (DSC) and optical polarizing microscope. The DSC and thermogravimetric analysis (TGA) show that these materials posses excellent thermal stability and have decomposition temperatures in excess of 300 degrees C. Beyond 160 degrees C both molecules show a smectic A liquid crystalline phase that exists till about 240 degrees C. Field-effect transistors were fabricated by vacuum evaporating the semiconductor layer using standard bottom gate/top contact geometry. The devices exhibit p-channel behaviour with hole mobilities of 10(-2) cm(2)/Vs. (C) 2009 Elsevier B.V. All rights reserved.

Polymorphism in Opto-Electronic Materials with a Benzothiazole-fluorene Core: A Consequence of High Conformational Flexibility of pi-Conjugated Backbone and Alkyl Side Chains

Fluorene and its derivatives are well-known organic semiconducting materials in the field of opto-electronic devices because of their charge transport properties. Three new organic semiconducting materials, namely, 2,2'-((9,9-butyl-9H-fluorene-2,7-diyl)bis(4,1 phenylene))bisbenzod]thiazole, C4; 2,2'-((octyl-9H-fluorene-2,7-diyl)bis(4,1 phenylene))bisbenzod]thiazole, C8; and 2,2'-((9,9-dodecayl-9H-fluorene-2,7-diyl)bis(4,1 phenylene))bisbenzod]thiazole, C12 with a benzothiazole-fluorene backbone, were synthesized and characterized for their photophysical properties. A phenomenon of concomitant polymorphism has been investigated in the first two derivatives (C4 and C8) and has been analyzed systematically in terms of the packing characteristics involving pi ... pi interactions. The conformational flexibility of the pi-conjugated 2,2'-(fluorene-2,7-diyl)bis(4,1 phenylene)bisbenzod]thiazole backbone coupled with orientational freedom of the terminal alkyl chains were found to be the key factors responsible for these polymorphic modifications. Attempts to grow suitable crystals for single crystal X-ray diffraction of compound C12 were unsuccessful.

Synthesis, antimicrobial and cytotoxic activities of pyrimidinyl benzoxazole, benzothiazole and benzimidazole

A variety of pyrimidinyl benzoxazoles, benzothiazoles and benzimidazoles linked by thio, methylthio and amino moieties were prepared and studied their antimicrobial and cytotoxic activities. The compound pyrimidinyl bis methylthio benzimidazole 22 was a potent antimicrobial agent particularly against Staphylococcus aureus (29 mm, MIC 12.5 mu g/mL) and Penicillium chrysogenum (38 mm, MIC 12.5 mu g/mL). The amino linked pyrimidinyl bis benzothiazole 24 exhibited cytotoxic activity on A549 cells with IC50 value of 10.5 mu M. (C) 2014 Elsevier Masson SAS. All rights reserved.

A new strategy of enhancing two-photon absorption in benzothiazole-containing fluorene molecules: Introduction of auxiliary donor-acceptor effects

A series of benzothiazole-containing fluorene molecules have been designed and their one- and two-photon absorption properties have been investigated theoretically by using the ZINDO method. The effects of electron-excessive/deficient heterocyclic bridges as auxiliary donors (auxD)/acceptors (auxA) on TPA cross-sections were studied. The results show that the molecules with D-pi-auxA-A, D-aux D-pi-A, or D-auxD-pi-auxA-A structure types have large TPA cross-section, which can be a valuable strategy in the design of two-photon absorption materials. Also, a linear relationship between the first hyperpolarizability and the TPA cross-section is observed. (c) 2006 Elsevier B.V. All rights reserved.

Determination of heat capacities and thermodynamic properties of 2-(chloromethylthio)benzothiazole by an adiabatic calorimeter

The molar heat capacities of 2-(chloromethylthio)benzothiazole (molecular formula C8H6ClNS2, CA registry no. 28908-00-1) were measured with an adiabatic calorimeter in the temperature range between (80 and 350) K. The construction and procedures of the calorimeter were described in detail. The performance of the calorimetric apparatus was evaluated by heat capacity measurements on alpha-Al2O3. The deviation of experiment heat capacities from the corresponding smoothed values lies within 0.3%, whereas the uncertainty is within +/-0.5%, compared with that of the recommended reference data over the whole experimental temperature range. A fusion transition was found from the C-p-T curve of 2-(chloromethylthio)benzothiazole. The melting temperature and the molar enthalpy and entropy of fusion of the compound were determined to be T-m = (315.11 +/- 0.04) K, Delta(fus)H(m) = (17.02 +/- 0.03) kJ(.)mol(-1), and Delta(fus)S(m) = (54.04 +/- 0.05) J(.)mol(-1.)K(-1), respectively. The thermodynamic functions (H-T - H-298.15) and (S-T - S-298.15) were also derived from the heat capacity data. The molar fraction purity of the 2-(chloromethylthio)benzothiazole sample used in the present calorimetric study was determined to be 99.21 by fraction melting.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

Synthesis and characterization of thermally stable second-order nonlinear optical side-chain polyimides containing thiazole and benzothiazole push-pull chromophores

Push-pull nonlinear optical (NLO) chromophores containing thiazole and benzothiazole acceptors were synthesized and characterized. Using these chromophores a series of second-order NLO polyimides were Successfully prepared from 4,4'-(hexafluoroisopropylidene) diphthalic anhydride (6FDA), pyromellitic dianhydride (PMDA) and 3,3'4,4'-benzophenone tetracarboxylic dianhydride (BTDA) by a standard condensation polymerization technique. These polyimides exhibit high glass transition temperatures ranging from 160 to 188 degrees C. UV-vis spectrum of polyimide exhibited a slight blue shift and decreases in absorption due to birefringence. From the order parameters, it was found that chromophores were aligned effectively. Using in situ poling and temperature ramping technique, the optical temperatures for corona poling were obtained. It was found that the optimal temperatures of polyimides approach their glass transition temperatures. These polyimides demonstrate relatively large d(33) values range between 35.15 and 45.20 pm/V at 532 nm. (C) 2008 Elsevier B.V. All rights reserved.

Separation of lanthanides and actinides(III) using tridentate benzimidazole, benzoxazole and benzothiazole ligands

The ability of new hydrophobic tridentate ligands based on 2,6-bis(benziinidazol-2-yl)pyridine, 2,6-bis(benzoxazol-2-yl)pyridine and 2,6-bis(benzothiazol-2-yl)pyridine to selectively extract americium(III) from europium(III) was measured. The most promising ligand-2,6-bis(benzoxazol-2-yl)-4-(2-decyl-1-tetradecyloxy)pyridine L-9 was found to give separation factors (SFAm/Eu) of up to 70 when used to extract cations from 0.02-0.10 M HNO3 into TPH in synergy with 2-bromodecanoic acid. Six structures of lanthanide complexes with 2,6-bis(benzoxazol-2-yl)pyridine L-6 were then determined to evaluate the types of species that are likely to be involved in the separation process. Three structural types were observed, namely [LnL(6)(NO3)(3)(H2O)2], 11-coordinate only for La, [LnL(6) (NO3)(3) (CH3CN)], 10-coordinate for Pr, Nd and Eu and [LnL(6) (NO3)(3)(H2O)], L 10-coordinate for Eu and Gd. Quantum Mechanics calculations were carried out on the tridentate ligands to elucidate the conformational preferences of the ligands in the free state and protonated and diprotonated forms and to assess the electronic properties of the ligands for comparison with other terdentate ligands used in lanthanide/actinide separation processes.

Synthesis, chemical, electrochemical characterization of oxomolybdenum(V) complexes of 2-(3,5-dimethyl pyrazol-1-yl) benzothiazole ligand: crystal structure of ligand and oxomolybdenum(VI) complex and density functional theory (DFT) calculation

This work reports the ligational behavior of the neutral bidentate chelating molecule 2-(3,5-dimethyl pyrazol-1-yl) benzothiazole towards the oxomolybdenum(V) center. Both mononuclear complexes of the type (MoOX3L)-O-V and binuclear complexes of the formula (Mo2O4X2L2)-O-V (where X = Cl, Br) are isolated in the solid state. The complexes are characterized by elemental analyses, various spectroscopic techniques (UV-Vis IR), magnetic susceptibility measurement at room temperature, and cyclic voltammetry for their redox behavior at a platinum electrode in CH3CN. The mononuclear complexes (MoOX3L)-O-V are found to be paramagnetic while the binuclear complexes Mo2O4X2L2 are diamagnetic. Crystal and molecular structure of the ligand and the dioxomolybdenum complex (MoO2Br2L)-O-VI (obtained from the complex MoOBr3L during crystallization) have been solved by single crystal X-ray diffraction technique. Relevant DFT calculations of the ligand and the complex (MoO2Br2L)-O-VI are also carried out.

A broad study of two new promising antimycobacterial drugs: Ag(I) and Au(I) complexes with 2-(2-thienyl)benzothiazole

Synthesis, characterization, DFT simulation and biological assays of two new metal complexes of 2-(2-thienyl)benzothiazole - BTT are reported. The complexes [Ag(BTT)(2)NO3] - AgBTT2 and [Au(BTT)Cl]center dot 1/2H(2)O - AuBTT were obtained by mixing the ligand with silver (I) nitrate or gold(I) chloride in methanolic solution. Characterization of the complexes were based on elemental (C, H, N and S), thermal (TG-DTA) analysis, C-13 and H-1 NMR, FT-IR and UV-Vis spectroscopic measurements, as well as the X-ray structure determination for AgBTT2. Spectroscopic data predicted by DFT calculations were in agreement with the experimental data for both complexes. The ligand BTT was synthesized by the condensation of 2-thiophenecarboxaldehyde and 2-aminothiophenol in a microwave furnace. AgBTT2 has a monomeric structure. Both complexes show a good activity against Mycobacterium tuberculosis. Free BIT shows low antitubercular activity. (C) 2012 Elsevier Ltd. All rights reserved.

A broad study of two new promising antimycobacterial drugs: Ag(I) and Au(I) complexes with 2-(2-thienyl)benzothiazole

Synthesis, characterization, DFT simulation and biological assays of two new metal complexes of 2-(2-thienyl)benzothiazole - BTT are reported. The complexes [Ag(BTT)(2)NO3] - AgBTT2 and [Au(BTT)Cl]center dot 1/2H(2)O - AuBTT were obtained by mixing the ligand with silver (I) nitrate or gold(I) chloride in methanolic solution. Characterization of the complexes were based on elemental (C, H, N and S), thermal (TG-DTA) analysis, C-13 and H-1 NMR, FT-IR and UV-Vis spectroscopic measurements, as well as the X-ray structure determination for AgBTT2. Spectroscopic data predicted by DFT calculations were in agreement with the experimental data for both complexes. The ligand BTT was synthesized by the condensation of 2-thiophenecarboxaldehyde and 2-aminothiophenol in a microwave furnace. AgBTT2 has a monomeric structure. Both complexes show a good activity against Mycobacterium tuberculosis. Free BIT shows low antitubercular activity. (C) 2012 Elsevier Ltd. All rights reserved.

An unusual ruthenium(II) complex of 2-(2-pyridyl)benzothiazole

The ligand 2-(2-pyridyl)benzothiazole (L) can act both as an N-N and an N-S chelating donor. The latter coordination mode is expected to be preferred when it is involved in coordination to Ru(II) which is a soft acceptor centre However, in the title compound, chlorobis(acetonitrile)triphenylphosphino-2-(2-pyridyl)benzothiazole-N,N-ruthenium(II) chlride, [Ru(L)(PPh3(CH3CN)2Cl]Cl, the ligand acts in N,N-bidentate manner and the Ru(II) ion is found to be present in an N4PCl coordination environment. PPh3 and Cl are trans to each other and the two CH3CN ligands occupy cis positions facing the NN donor atoms of ligand L.

Synthesis and Antileukemic Activity of 1-((S)-2-Amino-4,5,6,7-tetrahydrobenzo[d]thiazol-6-yl)-3-(substituted phenyl)urea Derivatives

Heterocyclic urea derivatives play an important role as anticancer agents because of their good inhibitory activity against receptor tyrosine kinases (RTKs), raf kinases, protein tyrosine kinases (PTKs), and NADH oxidase, which play critical roles in many aspects of tumorigenesis. Benzothiazole moiety constitutes an important scaffold of drugs, possessing several pharmacological functions, mainly the anticancer activity. Based on these interesting properties of benzothiazoles and urea moiety to obtain new biologically active agents, we synthesized a series of novel 1-((S)-2-amino-4,5,6.7-tetrahydrobenzo[d]thiazol-6-yl)-3-(substituted phenyl)urea derivatives and evaluated for their efficacy as antileukemic agents against two human leukemic cell lines (K562 and Reh). These compounds showed good and moderate cytotoxic effect to cancer cell lines tested. Compounds with electron-withdrawing chloro and fluoro substituents on phenyl ring showed good activity and compounds with electron-donating methoxy group showed moderate activity. Compound with electron-withdrawing dichloro substitution on phenyl ring of aryl urea showed good activity. Further, lactate dehydrogenase (LDH) assay, flow cytometric analysis of annexin V-FITC/propidium iodide (PI) double staining and DNA fragmentation studies showed that compound with dichloro substitution on phenyl ring of aryl urea can induce apoptosis.