Extracellular matrix remodeling of the testes through the male reproductive cycle in Teleostei fish

During the fish reproductive cycle, testes undergo morphological changes related to germinal epithelium and remodeling of extracellular matrix components (ECM). ECM is degraded mainly by action of matrix metalloproteinases (MMPs). Due to the natural renewal of ECM in fish testes, we choose Pimelodus maculatus to study remodeling of ECM throughout reproductive cycle, using picrosirius (to identify type I, II, III collagen) and reticulin (type III collagen), and to immunolocalize MT1-MMP (membrane type 1-matrix metalloproteinase) and MMP-2 in testis cells. Testes were classified in four reproductive phases: regenerating, development, spawning capable and regressing. Picrosirius and reticulin demonstrated a differential distribution of total collagen fibers during the reproductive cycle. Immunohistochemistry showed MT1-MMP only in acidophilic granulocyte cells mainly inside blood vessels, in connective tissue of capsule close to the germinal compartment, and also infiltrated in interstitial connective tissue. MMP-2 was detected in fibroblast and endothelial cells of interstitial and capsule blood vessels, in epithelial cells of capsule, and in acidophilic granulocyte cells at same description for MT1-MMP. The fish testes ECM were remodeled throughout reproductive cycle in according to morphophysiological alterations. During reproductive season (spawning capable), the interstitium increased in total collagen fibers (type I, II, III). After spermiation period (regression and regenerating), the amount of collagen fibers decreased in response to action of MMPs on collagen degradation and other interstitial components (not assessed in this study). MMPs seem to be indispensable components for natural cyclic events of ECM remodeling of fish testes and for guarantee tissue homeostasis throughout reproductive cycle.

Living and dying for inflammation: neutrophils, eosinophils, basophils

Neutrophils, eosinophils, and basophils play essential roles during microbe-induced and sterile inflammation. The severity of such inflammatory processes is controlled, at least in part, by factors that regulate cell death and survival of granulocytes. In recent years, major progress has been made in understanding the molecular mechanisms of granulocyte cell death and in identifying novel damage- and pathogen-associated molecular patterns as well as regulatory cytokines impacting granulocyte viability. Furthermore, an increased interest in innate immunity has boosted our overall understanding of granulocyte biology. In this review, we describe and compare factors and mechanisms regulating neutrophil, eosinophil, and basophil lifespan. Because dysregulation of death pathways in granulocytes can contribute to inflammation-associated immunopathology, targeting granulocyte lifespan could be therapeutically promising.

The endogenous granulocyte colony-stimulating factor response following autologous peripheral blood stem cell transplantation is inpaired in patients with myeloma

Granulocyte colony-stimulating factor (G-CSF) levels were studied in 23 patients (10 myeloma, 13 relapsed Hodgkin's disease, non-Hodgkin's lymphoma or germ cell tumours), post autologous peripheral blood stem cell transplantation (PBSCT). The two groups had similar previous chemotherapy and numbers of CD34+ cells transplanted. All patients received G-CSF by injection starting 8 d post transplantation. Twenty out of 23 patients showed raised endogenous levels of G-CSF before cytokine administration. Myeloma patients showed significantly lower levels of endogenous G-CSF than the other patients (0.767 versus 3.262 ng/ml, P <0.05). Further rises in G-CSF levels were seen following the administration of exogenous G-CSF which then fell, despite ongoing administration of G-CSF, as neutrophil recovery occurred.

Granulocyte-macrophage precursor cell and colony-stimulating factor responses of mice infected with Salmonella typhimurium

The response of granulocyte-macrophage progenitor cells (in vitro colony-forming cells) and of colony-stimulating (CS) factor in serum were studied in mice infected intraperitoneally with 10(3) viable Salmonella typhimurium. Increases in the number of colony-forming cells in marrow and spleen and increases in the serum level of CS factor occurred during the infection. There was no evidence to suggest that progressive infection was associated with failure of macrophage production. Medium rich in CS factor increased the bactericidal activity of macrophages in vitro and it was suggested that CS factor could be involved in macrophage activation.

Granulocyte macrophage colony-stimulating factor enhances the modulatory effect of cytokines on monocyte-derived multinucleated giant cell formation and fungicidal activity against Paracoccidioides brasiliensis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Role of plerixafor in autologous stem cell mobilization with vinorelbine chemotherapy and granulocyte-colony stimulating factor in patients with myeloma: a phase II study (PAV-trial)

Current practice in Switzerland for the mobilization of autologous stem cells in patients with myeloma is combining vinorelbine chemotherapy and granulocyte-colony stimulating factor (G-CSF) cytokine stimulation. We prospectively investigated adding intravenous plerixafor to the vinorelbine/G-CSF combination (VGP), and compared it with vinorelbine/plerixafor (VP) and G-CSF/plerixafor (GP) combinations. In a final cohort (VP-late), plerixafor was given on the first day of CD34 + cells increasing to > 15 000/mL peripheral blood. Four consecutive cohorts of 10 patients with myeloma were studied. We observed that intravenously administered plerixafor can be safely combined with vinorelbine/G-CSF. VGP was superior in mobilizing peripheral stem and progenitor cells compared to the three double combinations (VP, GP and VP-late), and GP mobilized better than VP. Our data indicate that the triple combination of VGP is an efficient strategy to collect autologous CD34 + cells, with G-CSF contributing predominantly in this concept. Plerixafor can be safely added to G-CSF and/or vinorelbine chemotherapy.

T cell functions in granulocyte/macrophage colony-stimulating factor deficient mice

Immunological functions were analyzed in mice lacking granulocyte/macrophage colony-stimulating factor (GM-CSF). The response of splenic T cells to allo-antigens, anti-mouse CD3 mAb, interleukin 2 (IL-2), or concanavalin A was comparable in GM-CSF +/+ and GM-CSF −/− mice. To investigate the responses of CD8+ and CD4+ T cells against exogenous antigens, mice were immunized with ovalbumin peptide or with keyhole limpet hemocyanin (KLH). Cytotoxic CD8+ T cells with specificity for ovalbumin peptide could not be induced in GM-CSF −/− mice. After immunization with KLH, there was a delay in IgG generation, particularly IgG2a, in GM-CSF −/− mice. Purified CD4+ T cells from GM-CSF −/− mice immunized with KLH showed impaired proliferative responses and produced low amounts of interferon-γ (IFN-γ) and IL-4 when KLH-pulsed B cells or spleen cells were used as antigen presenting cells (APC). When enriched dendritic cells (DC) were used as APC, CD4+ T cells from GM-CSF −/− mice proliferated as well as those from GM-CSF +/+ mice and produced high amounts of IFN-γ and IL-4. To analyze the rescue effect of DC on CD4+ T cells, supernatants from (i) CD4+ T cells cultured with KLH-pulsed DC or (ii) DC cultured with recombinant GM-CSF were transferred to cultures of CD4+ T cells and KLH-pulsed spleen cells from GM-CSF −/− mice. Supernatants from both DC sources contained a factor or factors that restored proliferative responses and IFN-γ production of CD4+ T cells from GM-CSF −/− mice.

Improved retroviral gene transfer into murine and Rhesus peripheral blood or bone marrow repopulating cells primed in vivo with stem cell factor and granulocyte colony-stimulating factor.

In previous studies we showed that 5 days of treatment with granulocyte colony-stimulating factor (G-CSF) and stem cell factor (SCF) mobilized murine repopulating cells to the peripheral blood (PB) and that these cells could be efficiently transduced with retroviral vectors. We also found that, 7-14 days after cytokine treatment, the repopulating ability of murine bone marrow (BM) increased 10-fold. In this study we examined the efficiency of gene transfer into cytokine-primed murine BM cells and extended our observations to a nonhuman primate autologous transplantation model. G-CSF/SCF-primed murine BM cells collected 7-14 days after cytokine treatment were equivalent to post-5-fluorouracil BM or G-CSF/SCF-mobilized PB cells as targets for retroviral gene transfer. In nonhuman primates, CD34-enriched PB cells collected after 5 days of G-CSF/SCF treatment and CD34-enriched BM cells collected 14 days later were superior targets for retroviral gene transfer. When a clinically approved supernatant infection protocol with low-titer vector preparations was used, monkeys had up to 5% of circulating cells containing the vector for up to a year after transplantation. This relatively high level of gene transfer was confirmed by Southern blot analysis. Engraftment after transplantation using primed BM cells was more rapid than that using steady-state bone marrow, and the fraction of BM cells saving the most primitive CD34+/CD38- or CD34+/CD38dim phenotype increased 3-fold. We conclude that cytokine priming with G-CSF/SCF may allow collection of increased numbers of primitive cells from both the PB and BM that have improved susceptibility to retroviral transduction, with many potential applications in hematopoietic stem cell-directed gene therapy.

Vaccination with syngeneic, lymphoma-derived immunoglobulin idiotype combined with granulocyte/macrophage colony-stimulating factor primes mice for a protective T-cell response.

The idiotype of the Ig expressed by a B-cell malignancy (Id) can serve as a unique tumor-specific antigen and as a model for cancer vaccine development. In murine models of Id vaccination, formulation of syngeneic Id with carrier proteins or adjuvants induces an anti-idiotypic antibody response. However, inducing a potent cell-mediated response to this weak antigen instead would be highly desirable. In the 38C13 lymphoma model, we observed that low doses of free granulocyte/macrophage colony-stimulating factor (GM-CSF) 10,000 units i.p. or locally s.c. daily for 4 days significantly enhanced protective antitumor immunity induced by s.c. Id-keyhole limpet hemocyanin (KLH) immunization. This effect was critically dependent upon effector CD4+ and CD8+ T cells and was not associated with any increased anti-idiotypic antibody production. Lymphocytes from spleens and draining lymph nodes of mice primed with Id-KLH plus GM-CSF, but not with Id-KLH alone, demonstrated significant proliferation to Id in vitro without any biased production of interferon gamma or interleukin 4 protein or mRNA. As a further demonstration of potency, 50% of mice immunized with Id-KLH plus GM-CSF on the same day as challenge with a large s.c. tumor inoculum remained tumor-free at day 80, compared with 17% for Id-KLH alone, when immunization was combined with cyclophosphamide. Taken together, these results demonstrate that GM-CSF can significantly enhance the immunogenicity of a defined self-antigen and that this effect is mediated exclusively by activating the T-cell arm of the immune response.

Cell acidification in apoptosis: granulocyte colony-stimulating factor delays programmed cell death in neutrophils by up-regulating the vacuolar H(+)-ATPase.

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Donor pretreatment with progenipoietin-1 is superior to granulocyte colony-stimulating factor in preventing graft-versus-host disease after allogeneic stem cell transplantation

The granulocyte colony-stimulating factor (G-CSF) and Fit-3 receptor agonist progenipoietin-1 (ProGP-1) has potent effects on dendritic cell (DC) expansion and may be an alternative to G-CSF for the mobilization of stem cells for allogeneic stem cell transplantation (SCT). We studied the ability of stem cell grafts mobilized with this agent to induce graft-versus-host disease (GVHD) to minor and major histocompatibility antigens in the well-described B6 --> B6D2F1 SCT model. ProGP-1, G-CSIF, or control diluent was administered to donor B6 mice. ProGP-1 expanded all cell lineages in the spleen, and unseparated splenocytes from these animals produced large amounts of interleukin 10 (IL-10) and transforming growth factor beta (TGFbeta) whereas the expression of T-cell adhesion molecules was diminished. Transplantation survival was 0%, 50%, and 90% in recipients of control-, G-CSF-, and ProGP-1-treated allogeneic donor splenocytes, respectively (P < .0001). Donor pretreatment with ProGP-1 allowed a 4-fold escalation in T-cell dose over that possible with G-CSF. Donor CD4 T cells from allogeneic SCT recipients of ProGP-1 splenocytes demonstrated an anergic response to host antigen, and cytokine production (interferon gamma [IFNγ], IL-4, and IL-10) was also reduced while CD8 T-cell cytotoxicity to host antigens remained intact. Neither CD11c(hi) DCs nor CD11c(dim)/B220(hi) DCs from ProGP-1-treated animals conferred protection from GVHD when added to control spleen. Conversely, when equal numbers of purified T cells from control-, G-CSF-, or ProGP-1-treated allogeneic donors were added to allogeneic T-cell-depleted control spleen, survival at day 60 was 0%, 15%, and 90%, respectively (P < .0001). The improved survival in recipients of ProGP-1 T cells was associated with reductions in systemic tumor necrosis factor alpha generation and GVHD of the gastrointestinal tract. We conclude that donor pretreatment with ProGP-1 is superior to G-CSIF for the prevention of GVHD after allogeneic SCT, primarily due to incremental affects on T-cell phenotype and function

Chronic graft-versus-host disease after granulocyte colony-stimulating factor-mobilized allogeneic stem cell transplantation: The role of donor T-cell dose and differentiation

The use of granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood as a source of stem cells has resulted in a high incidence of severe chronic graft-versus-host disease (cGVHD), which compromises the outcome of clinical allogeneic stem cell transplantation. We have studied the effect of G-CSF on both immune complex and fibrotic cGVHD directed to major (DBA/2 --> B6D2F1) or minor (B10.D2 --> BALB/c) histocompatibility antigens. In both models, donor pretreatment with G-CSF reduced cGVHD mortality in association with type 2 differentiation. However, after escalation of the donor T-cell dose, scleroderma occurred in 90% of the recipients of grafts from G-CSF-treated donors. In contrast, only 11% of the recipients of control grafts developed scleroderma, and the severity of hepatic cGVHD was also reduced. Mixing studies confirmed that in the presence of high donor T-cell doses, the severity of scleroderma was determined by the non-T-cell fraction of grafts from G-CSF-treated donors. These data confirm that the induction of cGVHD after donor treatment with G-CSF is dependent on the transfer of large numbers of donor T cells in conjunction with a putatively expanded myeloid lineage, providing a further rationale for the limitation of cell dose in allogeneic stem cell transplantation. (C) 2004 American Society for Blood and Marrow Transplantation.

Granulocyte-colony-stimulating factor mobilizes bone marrow stem cells in patients with subacute ischemic stroke: the Stem Cell Trial of Recovery EnhanceMent After Stroke (STEMS) Pilot Randomized, Controlled Trial (ISRCTN 16784092)

Background and Purpose - Loss of motor function is common after stroke and leads to significant chronic disability. Stem cells are capable of self-renewal and of differentiating into multiple cell types, including neurones, glia, and vascular cells. We assessed the safety of granulocyte-colony-stimulating factor (G-CSF) after stroke and its effect on circulating CD34 stem cells. Methods - We performed a 2-center, dose-escalation, double-blind, randomized, placebo-controlled pilot trial (ISRCTN 16784092) of G-CSF (6 blocks of 1 to 10 g/kg SC, 1 or 5 daily doses) in 36 patients with recent ischemic stroke. Circulating CD34 stem cells were measured by flow cytometry; blood counts and measures of safety and functional outcome were also monitored. All measures were made blinded to treatment. Results - Thirty-six patients, whose mean SD age was 768 years and of whom 50% were male, were recruited. G-CSF (5 days of 10 g/kg) increased CD34 count in a dose-dependent manner, from 2.5 to 37.7 at day 5 (area under curve, P0.005). A dose-dependent rise in white cell count (P0.001) was also seen. There was no difference between treatment groups in the number of patients with serious adverse events: G-CSF, 7/24 (29%) versus placebo 3/12 (25%), or in their dependence (modified Rankin Scale, median 4, interquartile range, 3 to 5) at 90 days. Conclusions - ”G-CSF is effective at mobilizing bone marrow CD34 stem cells in patients with recent ischemic stroke. Administration is feasible and appears to be safe and well tolerated. The fate of mobilized cells and their effect on functional outcome remain to be determined. (Stroke. 2006;37:2979-2983.)

Co-administration of plasmid-encoded granulocyte-macrophage colony-stimulating factor increases human immunodeficiency virus-1 DNA vaccine-induced polyfunctional CD4+ T-cell responses

T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+ T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.