A 22-nt artificial microRNA mediates widespread RNA silencing in Arabidopsis

It is known that 22-nucleotide (nt) microRNAs (miRNAs) derived from asymmetric duplexes trigger phased small-interfering RNA (phasiRNA) production from complementary targets. Here we investigate the efficacy of 22-nt artificial miRNA (amiRNA)-mediated RNA silencing relative to conventional hairpin RNA (hpRNA) and 21-nt amiRNA-mediated RNA silencing. CHALCONE SYNTHASE (CHS) was selected as a target in Arabidopsis thaliana due to the obvious and non-lethal loss of anthocyanin accumulation upon widespread RNA silencing. Over-expression of CHS in the pap1-D background facilitated visual detection of both local and systemic RNA silencing. RNA silencing was initiated in leaf tissues from hpRNA and amiRNA plant expression vectors under the control of an Arabidopsis RuBisCo small subunit 1A promoter (SSU). In this system, hpRNA expression triggered CHS silencing in most leaf tissues but not in roots or seed coats. Similarly, 21-nt amiRNA expression from symmetric miRNA/miRNA* duplexes triggered CHS silencing in all leaf tissues but not in roots or seed coats. However, 22-nt amiRNA expression from an asymmetric duplex triggered CHS silencing in all tissues, including roots and seed coats, in the majority of plant lines. This widespread CHS silencing required RNA-DEPENDENT RNA POLYMERASE6-mediated accumulation of phasiRNAs from the endogenous CHS transcript. These results demonstrate the efficacy of asymmetric 22-nt amiRNA-directed RNA silencing and associated phasiRNA production and activity, in mediating widespread RNA silencing of an endogenous target gene. Asymmetric 22-nt amiRNA-directed RNA silencing requires little modification of existing amiRNA technology and is expected to be effective in suppressing other genes and/or members of gene families.

Hairpin RNAs derived from RNA polymerase II and polymerase III promoter-directed transgenes are processed differently in plants

RNA polymerase III (Pol III) as well as Pol II (35S) promoters are able to drive hairpin RNA (hpRNA) expression and induce target gene silencing in plants. siRNAs of 21 nt are the predominant species in a 35S Pol II line, whereas 24- and/or 22-nucleotide (nt) siRNAs are produced by a Pol III line. The 35S line accumulated the loop of the hpRNA, in contrast to full-length hpRNA in the Pol III line. These suggest that Pol II and Pol III-transcribed hpRNAs are processed by different pathways. One Pol III transgene produced only 24-nt siRNAs but silenced the target gene efficiently, indicating that the 24-nt siRNAs can direct mRNA degradation; specific cleavage was confirmed by 59 rapid amplification of cDNA ends (RACE). Both Pol II- and Pol III-directed hpRNA transgenes induced cytosine methylation in the target DNA. The extent of methylation is not correlated with the level of 21-nt siRNAs, suggesting that they are not effective inducers of DNA methylation. The promoter of a U6 transgene was significantly methylated, whereas the promoter of the endogenous U6 gene was almost free of cytosine methylation, suggesting that endogenous sequences are more resistant to de novo DNA methylation than are transgene constructs. Published by Cold Spring Harbor Laboratory Press. Copyright © 2008 RNA Society.

Small but influential: the role of microRNAs on gene regulatory network and 3 ' UTR evolution

MicroRNAs (miRNAs) are endogenous similar to 22 nucleotide noncoding RNAs that regulate the expression of complementary messenger RNAs (mRNAs). Thousands of miRNA genes have been found in diverse species, and many of them are highly conserved. With the mi

MicroRNAs Modulate Hematopoietic Lineage Differentiation

MicroRNAs (miRNAs), an abundant class of ~22 nucleotide non-coding RNAs, are thought to play an important regulatory role in animal and plant development at the posttranscriptional level. Many miRNAs cloned from mouse bone marrow cells are differentially regulated in various hematopoietic lineages, suggesting that they might influence hematopoietic lineage differentiation. Some human miRNAs are linked to leukemias: the miR-15a/miR-16 locus is frequently deleted or down-regulated in patients with B-cell chronic lymphocytic leukemia and miR-142 is at a translocation site found in a case of aggressive B-cell leukemia. miR-181, a miRNA upregulated only in the B cell lineage of mouse bone marrow cells, promotes B cell differentiation and inhibits production of CD8⁺ T cells when expressed in hematopoietic stem/progenitor cells. In contrast miR-142s inhibits production of both CD4⁺ and CD8⁺ T cells and does not affect B cells. Collectively, these results indicate that microRNAs are components of the molecular circuitry controlling mouse hematopoiesis and suggest that other microRNAs have similar regulatory roles during other facets of vertebrate development.

Complete genome sequences of both biotypes of a virus pair of bovine viral diarrhea virus subgenotype 1k

We determined the complete genome sequences of both biotypes of a virus pair of bovine viral diarrhea virus (BVDV) subgenotype 1k. The viruses were isolated from a persistently infected calf suffering from mucosal disease. Compared to the noncytopathic biotype, the cytopathic biotype contains an insertion of 84 nucleotides and 22 nucleotide changes.

The role of non-coding RNA in the development of pulmonary arterial hypertension

Pulmonary arterial hypertension (PAH) is a progressive disease of the small pulmonary arteries, characterised by pulmonary vascular remodelling due to excessive proliferation and resistance to apoptosis of pulmonary artery endothelial cells (PAECs) and pulmonary artery smooth muscle cells (PASMCs). The increased pulmonary vascular resistance and elevated pulmonary artery pressures result in right heart failure and premature death. Germline mutations of the bone morphogenetic protein receptor-2 (bmpr2) gene, a receptor of the transforming growth factor beta (TGF-β) superfamily, account for approximately 75%-80% of the cases of heritable form of PAH (HPAH) and 20% of sporadic cases or idiopathic PAH (IPAH). IPAH patients without known bmpr2 mutations show reduced expression of BMPR2. However only ~ 20% of bmpr2-mutation carriers will develop the disease, due to an incomplete penetrance, thus the need for a ‘second hit’ including other genetic and/or environmental factors is accepted. Diagnosis of PAH occurs most frequently when patients have reached an advanced stage of disease. Although modern PAH therapies can markedly improve a patient’s symptoms and slow the rate of clinical deterioration, the mortality rate from PAH remains unacceptably high. Therefore, the development of novel therapeutic approaches is required for the treatment of this multifaceted disease. Noncoding RNAs (ncRNAs) include microRNAs (miRNAs) and long noncoding RNAs (lncRNAs). MiRNAs are ~ 22 nucleotide long and act as negative regulators of gene ex-pression via degradation or translational inhibition of their target mRNAs. Previous studies showed extensive evidence for the role of miRNAs in the development of PAH. LncRNAs are transcribed RNA molecules greater than 200 nucleotides in length. Similar to classical mRNA, lncRNAs are translated by RNA polymerase II and are generally alternatively spliced and polyadenylated. LncRNAs are highly versatile and function to regulate gene expression by diverse mechanisms. Unlike miRNAs, which exhibit well-defined actions in negatively regulating gene expression via the 3’-UTR of mRNAs, lncRNAs play more diverse and unpredictable regulatory roles. Although a number of lncRNAs have been intensively investigated in the cancer field, studies of the role of lncRNAs in vascular diseases such as PAH are still at a very early stage. The aim of this study was to investigate the involvement of specific ncRNAs in the development of PAH using experimental animal models and cell culture. The first ncRNA we focused on was miR-143, which is up-regulated in the lung and right ventricle tissues of various animal models of PH, as well as in the lungs and PASMCs of PAH patients. We show that genetic ablation of miR-143 is protective against the development of chronic hypoxia induced PH in mice, assessed via measurement of right ventricular systolic pressure (RVSP), right ventricular hypertrophy (RVH) and pulmonary vascular remodelling. We further report that knockdown of miR-143-3p in WT mice via anti-miR-143-3p administration prior to exposure of mice to chronic hypoxia significantly decreases certain indices of PH (RVSP) although no significant changes in RVH and pulmo-nary vascular remodelling were observed. However, a reversal study using antimiR-143-3p treatment to modulate miR-143-3p demonstrated a protective effect on RVSP, RVH, and muscularisation of pulmonary arteries in the mouse chronic hypoxia induced PH model. In vitro experiments showed that miR-143-3p overexpression promotes PASMC migration and inhibits PASMC apoptosis, while knockdown miR-143-3p elicits the opposite effect, with no effects observed on cellular proliferation. Interestingly, miR-143-3p-enriched exosomes derived from PASMCs mediated cell-to-cell communication between PASMCs and PAECs, contributing to the pro-migratory and pro-angiogenic phenotype of PAECs that underlies the pathogenesis of PAH. Previous work has shown that miR-145-5p expression is upregulated in the chronic hypoxia induced mouse model of PH, as well as in PAH patients. Genetic ablation and pharmacological inhibition (subcutaneous injection) of miR-145-5p exert a protective against the de-velopment of PAH. In order to explore the potential for alternative, more lung targeted delivery strategies, miR-145-5p expression was inhibited in WT mice using intranasal-delivered antimiR-145-5p both prior to and post exposure to chronic hypoxia. The decreased expression of miR-145-5p in lung showed no beneficial effect on the development of PH compared with control antimiRNA treated mice exposed to chronic hypoxia. Thus, miR-143-3p modulated both cellular and exosome-mediated responses in pulmonary vascular cells, while the inhibition of miR-143-3p prevented the development of experimental pulmonary hypertension. We focused on two lncRNAs in this project: Myocardin-induced Smooth Muscle Long noncoding RNA, Inducer of Differentiation (MYOSLID) and non-annotated Myolnc16, which were identified from RNA sequencing studies in human coronary artery smooth muscle cells (HCASMCs) that overexpress myocardin. MYOSLID was significantly in-creased in PASMCs from patients with IPAH compared to healthy controls and increased in circulating endothelial progenitor cells (EPCs) from bmpr2 mutant PAH patients. Exposure of PASMCs to hypoxia in vitro led to a significant upregulation in MYOSLID expres-sion. MYOSLID expression was also induced by treatment of PASMC with BMP4, TGF-β and PDGF, which are known to be triggers of PAH in vitro. Small interfering RNA (siR-NA)-mediated knockdown MYOSLID inhibited migration and induced cell apoptosis without affecting cell proliferation and upregulated several genes in the BMP pathway in-cluding bmpr1α, bmpr2, id1, and id3. Modulation of MYOSLID also affected expression of BMPR2 at the protein level. In addition, MYOSLID knockdown affected the BMP-Smad and BMP-non-Smad signalling pathways in PASMCs assessed by phosphorylation of Smad1/5/9 and ERK1/2, respectively. In PAECs, MYOSLID expression was also induced by hypoxia exposure, VEGF and FGF2 treatment. In addition, MYOSLID knockdown sig-nificantly decreased the proliferation of PAECs. Thus, MYOSLID may be a novel modulator in pulmonary vascular cell functions, likely through the BMP-Smad and –non-Smad pathways. Treatment of PASMCs with inflammatory cytokines (IL-1 and TNF-α) significantly in-duced the expression of Myolnc16 at a very early time point. Knockdown of Myolnc16 in vitro decreased the expression of il-6, and upregulated the expression of il-1 and il-8 in PASMCs. Moreover, the expression levels of chemokines (cxcl1, cxcl6 and cxcl8) were sig-nificantly decreased with Myolnc16 knockdown. In addition, Myolnc16 knockdown decreased the MAP kinase signalling pathway assessed by phosphorylation of ERK1/2 and p38 MAPK and inhibited cell migration and proliferation in PASMCs. Thus, Myolnc16 may a novel modulator of PASMCs functions through anti-inflammatory signalling pathways. In summary, in this thesis we have demonstrated how miR-143-3p plays a protective role in the development of PH both in vivo animal models and patients, as well as in vitro cell cul-ture. Moreover, we have showed the role of two novel lncRNAs in pulmonary vascular cells. These ncRNAs represent potential novel therapeutic targets for the treatment of PAH with further work addressing to investigate the target genes, and the pathways modulated by these ncRNAs during the development of PAH.

Nucleotide sequence of coat protein gene for GPV isolate of barley yellow dwarf virus and construction of expression plasmid for plant

GPV is a Chinese serotype isolate of barley yellow dwarf virus (BYDV) that has no reaction with antiserum of MAV, PAV, SGV, RPV and RMV The sequence of the coat protein (CP) of GPV isolate of BYDV was identified and its amino acid sequence was deduced. The coding region for the putative GPV CP is 603 bases nucleotides and encodes a Mr 22 218 (22 ku) protein. The same as MAV, PAV and RPV, GPV contained a second ORF within the coat protein coding region. This protein of 17 024 Mr (17 ku) is thought to correspond to the Virion protein genome linked (Vpg). Sequence comparisons of the CP coding region between the GPV isolate of BYDV and other isolates of BYDV have been done. The nucleotide and amino acid sequence homology of GPV has a greater identity to the sequence of RPV than those of PAV and MAV. The GPV CP sequence stored 83.7% of nucleotide similarity and 77.5% of deduced amino acid similarity, whereas that of the PAV and MAV shared 56.9%, 53.2% and 44.1%, 43.8% respectively. According to BYDV-GPV CP sequence, two primers were designed. The cDNA of CP was produced by RT-PCR. Full-length cDNA of CP was inserted into plasmid to construct expression plasmids named pPPI1, pPPI2 and pPPI5 based on different promoters. The recombinant plasmids were identified by using α-32P-dATP labelled CP probe, α-32P-ATP labelled GPV RNA probe and sequencing to confirm real GPV CP gene cDNA in plasmids.

Characterization of disease resistance gene candidates of the nucleotide binding site (NBS) type from banana and correlation of a transcriptional polymorphism with resistance to Fusarium oxysporum f.sp. cubense race 4

Most plant disease resistance (R) genes encode proteins with a nucleotide binding site and leucine-rich repeat structure (NBS-LRR). In this study, degenerate primers were used to amplify genomic NBS-type sequences from wild banana (Musa acuminata ssp. malaccensis) plants resistant to the fungal pathogen Fusarium oxysporum formae specialis (f. sp.) cubense (FOC) race 4. Five different classes of NBS-type sequences were identified and designated as resistance gene candidates (RGCs). The deduced amino acid sequences of the RGCs revealed the presence of motifs characteristic of the majority of known plant NBS-LRR resistance genes. Structural and phylogenetic analyses grouped the banana RGCs within the non-TIR (homology to Toll/interleukin-1 receptors) subclass of NBS sequences. Southern hybridization showed that each banana RGC is present in low copy number. The expression of the RGCs was assessed by RT-PCR in leaf and root tissues of plants resistant or susceptible to FOC race 4. RGC1, 3 and 5 showed a constitutive expression profile in both resistant and susceptible plants whereas no expression was detected for RGC4. Interestingly, RGC2 expression was found to be associated only to FOC race 4 resistant lines. This finding could assist in the identification of a FOC race 4 resistance gene.

Studies on nucleotidases in plants - Reversible denaturation of the crystalline mung bean nucleotide pyrophosphatase and the effect of adenylates on the native and renatured enzyme

The crystalline mung bean nucleotide pyrophosphatase was inhibited nonlinearly by AMP, one of the products of the reaction. The partially inactive enzyme was specifically reactivated by ADP, and V at maximal activation was the same as that of the native enzyme. ATP was a linear, noncompetitive inhibitor. The kinetic evidence suggested that ADP and ATP might not be reacting at the same site as AMP. The electrophoretic mobility of the enzyme was increased by AMP, whereas ADP and ATP were without effect. The enzyme was denatured on treatment with urea or guanidine hydrochloride. The renatured and the native enzyme had the same pH (9.4) and temperature (49 °C) optimum. The Km (0.2 m ) and V (3.2) of the native enzyme increased on renaturation to 1.8 m and 8.0, respectively. In addition, renaturation resulted in desensitization of the enzyme to inhibition by low concentrations of AMP. Renaturation did not affect the reactivation of the apoenzyme by Zn2+.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Impaired formation of beta-adrenergic receptor-nucleotide regulatory protein complexes in pseudohypoparathyroidism.

Decreased activity of the guanine nucleotide regulatory protein (N) of the adenylate cyclase system is present in cell membranes of some patients with pseudohypoparathyrodism (PHP-Ia) whereas others have normal activity of N (PHP-Ib). Low N activity in PHP-Ia results in a decrease in hormone (H)-stimulatable adenylate cyclase in various tissues, which might be due to decreased ability to form an agonist-specific high affinity complex composed of H, receptor (R), and N. To test this hypothesis, we compared beta-adrenergic agonist-specific binding properties in erythrocyte membranes from five patients with PHP-Ia (N = 45% of control), five patients with PHP-Ib (N = 97%), and five control subjects. Competition curves that were generated by increasing concentrations of the beta-agonist isoproterenol competing with [125I]pindolol were shallow (slope factors less than 1) and were computer fit to a two-state model with corresponding high and low affinity for the agonist. The agonist competition curves from the PHP-Ia patients were shifted significantly (P less than 0.02) to the right as a result of a significant (P less than 0.01) decrease in the percent of beta-adrenergic receptors in the high affinity state from 64 +/- 22% in PHP-Ib and 56 +/- 5% in controls to 10 +/- 8% in PHP-Ia. The agonist competition curves were computer fit to a "ternary complex" model for the two-step reaction: H + R + N in equilibrium HR + N in equilibrium HRN. The modeling was consistent with a 60% decrease in the functional concentration of N, and was in good agreement with the biochemically determined decrease in erythrocyte N protein activity. These in vitro findings in erythrocytes taken together with the recent observations that in vivo isoproterenol-stimulated adenylate cyclase activity is decreased in patients with PHP (Carlson, H. E., and A. S. Brickman, 1983, J. Clin. Endocrinol. Metab. 56:1323-1326) are consistent with the notion that N is a bifunctional protein interacting with both R and the adenylate cyclase. It may be that in patients with PHP-Ia a single molecular and genetic defect accounts for both decreased HRN formation and decreased adenylate cyclase activity, whereas in PHP-Ib the biochemical lesion(s) appear not to affect HRN complex formation.

Detection of single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer using a fluorophore-tagged DNA probe

Single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer were identified using oligodeoxynucleotide probe sequences bearing internal anthracene fluorophores proximal to the SNP site. Depending upon the nature of the synthesised target sequences, probe-target duplex formation could lead to enhanced or attenuated fluorescence emission from the anthracene, enabling detection of a proximal base-pair as either matching or mismatching. © 2011 Elsevier Ltd. All rights reserved.

Impact of a cis-associated gene expression SNP on chromosome 20q11.22 on bipolar disorder susceptibility, hippocampal structure and cognitive performance.

BackgroundBipolar disorder is a highly heritable polygenic disorder. Recent enrichment analyses suggest that there may be true risk variants for bipolar disorder in the expression quantitative trait loci (eQTL) in the brain.AimsWe sought to assess the impact of eQTL variants on bipolar disorder risk by combining data from both bipolar disorder genome-wide association studies (GWAS) and brain eQTL.MethodTo detect single nucleotide polymorphisms (SNPs) that influence expression levels of genes associated with bipolar disorder, we jointly analysed data from a bipolar disorder GWAS (7481 cases and 9250 controls) and a genome-wide brain (cortical) eQTL (193 healthy controls) using a Bayesian statistical method, with independent follow-up replications. The identified risk SNP was then further tested for association with hippocampal volume (n = 5775) and cognitive performance (n = 342) among healthy individuals.ResultsIntegrative analysis revealed a significant association between a brain eQTL rs6088662 on chromosome 20q11.22 and bipolar disorder (log Bayes factor = 5.48; bipolar disorder P = 5.85×10(-5)). Follow-up studies across multiple independent samples confirmed the association of the risk SNP (rs6088662) with gene expression and bipolar disorder susceptibility (P = 3.54×10(-8)). Further exploratory analysis revealed that rs6088662 is also associated with hippocampal volume and cognitive performance in healthy individuals.ConclusionsOur findings suggest that 20q11.22 is likely a risk region for bipolar disorder; they also highlight the informative value of integrating functional annotation of genetic variants for gene expression in advancing our understanding of the biological basis underlying complex disorders, such as bipolar disorder.

Analysis of 16S rDNA sequences from pathogenic Leptospira serovars and use of single nucleotide polymorphisms for rapid speciation by D-HPLC

Leptospira have a worldwide distribution and include important zoonotic pathogens yet diagnosis and differentiation still tend to rely on traditional bacteriological and serological approaches. In this study a 1.3 kb fragment of the rrs gene (16S rDNA) was sequenced from a panel of 22 control strains, representing serovars within the pathogenic species Leptospira interrogans, Leptospira borgpetersenii, and Leptospira kirschneri, to identify single nucleotide polymorphisms (SNPs). These were identified in the 5' variable region of the 16S sequence and a 181 bp PCR fragment encompassing this region was used for speciation by Denaturing High Performance Liquid Chromatography (D-HPLC). This method was applied to eleven additional species, representing pathogenic, non-pathogenic and intermediate species and was demonstrated to rapidly differentiate all but 2 of the non-pathogenic Leptospira species. The method was applied successfully to infected tissues from field samples proving its value for diagnosing leptospiral infections found in animals in the UK. Crown Copyright (C) 2010 Published by Elsevier Ltd. All rights reserved.