935 resultados para response function
Resumo:
Patients with heart failure who have undergone partial left ventriculotomy improve resting left ventricular systolic function, but have limited functional capacity. We studied systolic and diastolic left ventricular function at rest and during submaximal exercise in patients with previous partial left ventriculotomy and in patients with heart failure who had not been operated, matched for maximal and submaximal exercise capacity. Nine patients with heart failure previously submitted to partial left ventriculotomy were compared with 9 patients with heart failure who had not been operated. All patients performed a cardiopulmonary exercise test with measurement of peak oxygen uptake and anaerobic threshold. Radionuclide left ventriculography was performed to analyze ejection fraction and peak filling rate at rest and during exercise at the intensity corresponding to the anaerobic threshold. Groups presented similar exercise capacity evaluated by peak oxygen uptake and at anaerobic threshold. Maximal heart rate was lower in the partial ventriculotomy group compared to the heart failure group (119 ± 20 vs 149 ± 21 bpm; P < 0.05). Ejection fraction at rest was higher in the partial ventriculotomy group as compared to the heart failure group (41 ± 12 vs 32 ± 9%; P < 0.0125); however, ejection fraction increased from rest to anaerobic threshold only in the heart failure group (partial ventriculotomy = 44 ± 17%; P = non-significant vs rest; heart failure = 39 ± 11%; P < 0.0125 vs rest; P < 0.0125 vs change in the partial ventriculotomy group). Peak filling rate was similar at rest and increased similarly in both groups at the anaerobic threshold intensity (partial ventriculotomy = 2.28 ± 0.55 EDV/s; heart failure = 2.52 ± 1.07 EDV/s; P < 0.0125; P > 0.05 vs change in partial ventriculotomy group). The abnormal responses demonstrated here may contribute to the limited exercise capacity of patients with partial left ventriculotomy despite the improvement in resting left ventricular systolic function.
Resumo:
Upper gastrointestinal endoscopy is often accompanied by tachycardia which is known to be an important pathogenic factor in the development of myocardial ischemia. The pathogenesis of tachycardia is unknown but the condition is thought to be due to the endocrine response to endoscopy. The purpose of the present study was to investigate the effects of sedation on the endocrine response and cardiorespiratory function. Forty patients scheduled for diagnostic upper gastrointestinal endoscopy were randomized into 2 groups. While the patients in the first group did not receive sedation during upper gastrointestinal endoscopy, the patients in the second group were sedated with intravenous midazolam at the dose of 5 mg for those under 65 years or 2.5 mg for those aged 65 years or more. Midazolam was administered by slow infusion. In both groups, blood pressure, ECG tracing, heart rate, and peripheral oxygen saturation (SpO2) were monitored during endoscopy. In addition, blood samples for the determination of cortisol, glucose and C-reactive protein levels were obtained from patients in both groups prior to and following endoscopy. Heart rate and systolic arterial pressure changes were within normal limits in both groups. Comparison of the two groups regarding the values of these two parameters did not reveal a significant difference, while a statistically significant reduction in SpO2 was found in the sedation group. No significant differences in serum cortisol, glucose or C-reactive protein levels were observed between the sedated and non-sedated group. Sedation with midazolam did not reduce the endocrine response and the tachycardia developing during upper gastrointestinal endoscopy, but increased the reduction in SpO2.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
There is a paucity of studies comparing social buffering in adolescents and adults, despite their marked differences in social behaviour. I investigated whether greater effects of social buffering on plasma corticosterone concentrations and expression of Zif268 in neural regions after an acute stressor would be found in adolescent compared with adult rats. Samples were obtained before and after one hour of isolation stress and after either one or three hours of recovery back in the colony with either a familiar or unfamiliar cage partner. Adolescent and adult rats did not differ in plasma concentrations of corticosterone at any time point. Corticosterone concentrations were higher after one hour isolation than at baseline (p < 0.001), and rats with a familiar partner during the recovery phase had lower corticosterone concentrations than did rats with an unfamiliar partner (p = 0.02). Zif268 immunoreactive cell counts were higher in the arcuate nucleus in both age groups after isolation (p = 0.007) and higher in the paraventricular nucleus of adolescents compared with adults during the recovery phase irrespective of partner familiarity. There was a significant decrease in immunoreactive cell counts after one hour isolation compared to baseline in the basolateral amygdala, central nucleus of the amygdala, and in the pyramidal layer of the hippocampus (all p < 0.05). An effect of partner familiarity on Zif268 immunoreactive cell counts was found in the granule layer of the dentate gyrus irrespective of age (higher in those with a familiar partner, p = 0.03) and in the medial prefrontal cortex in adolescents (higher with an unfamiliar partner, p = 0.02). Overall, the acute stress and partner familiarity produced a similar pattern of results in adolescents and adults, with both age groups sensitive to the social context.
Resumo:
The high ingestion of oleic (OLA) and linoleic (LNA) acids by Western populations, the presence of inflammatory diseases in these populations, and the importance of neutrophils in the inflammatory process led us to investigate the effects of oral ingestion of unesterified OLA and LNA on rat neutrophil function. Pure OLA and LNA were administered by gavage over 10 days. The doses used (0.11, 0.22 and 0.44 g/kg of body weight) were based on the Western consumption of OLA and LNA. Neither fatty acid affected food, calorie or water intake. The fatty acids were not toxic to neutrophils as evaluated by cytometry using propidium iodide (membrane integrity and DNA fragmentation). Neutrophil migration in response to intraperitoneal injection of glycogen and in the air pouch assay, was elevated after administration of either OLA or LNA. This effect was associated with enhancement of rolling and increased release of the chemokine CINC-2 alpha beta. Both fatty acids elevated l-selectin expression, whereas no effect on beta(2)-integrin expression was observed, as evaluated by flow cytometry. LNA increased the production of proinflammatory cytokines (IL-1 beta and CINC-2 alpha beta) by neutrophils after 4 h in culture and both fatty acids decreased the release of the same cytokines after 18 h. In conclusion, OLA and LNA modulate several functions of neutrophils and can influence the inflammatory process.
Resumo:
Patients with paracoccidioidomycosis (PCM) present marked involvement of the lungs during the course of the mycosis. The purpose of this work was to obtain bronchoalveolar lavage (BAL) fluid from these patients to study the cytopathology, TNF levels and the oxidative and fungicidal response of alveolar macrophages (AMs) to in vitro incubation with recombinant IFN-gamma. To compare the lung and blood compartments, these determinations were also made in plasma and blood monocytes (BMs) obtained from the same patients. The cytopathology of BAL fluid revealed a predominance of macrophages, but with the presence of neurrophil exudation, and rare lymphocytes and epithelioid and giant cells. Comparison of the oxidative status and fungicidal activity of AMs and circulating BMs demonstrated that both cell types are highly activated for these two functions when compared to control cells. However, TNF levels were higher in BAL fluid than in plasma. The possible mechanisms involved in the hyperresponsiveness of cells from PCM patients are discussed. (C) 2003 Editions scientifiques et medicales Elsevier SAS. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Background: The alpha-proteobacterium Caulobacter crescentus inhabits low-nutrient environments and can tolerate certain levels of heavy metals in these sites. It has been reported that C. crescentus responds to exposure to various heavy metals by altering the expression of a large number of genes. Results: In this work, we show that the ECF sigma factor sigma(F) is one of the regulatory proteins involved in the control of the transcriptional response to chromium and cadmium. Microarray experiments indicate that sigma(F) controls eight genes during chromium stress, most of which were previously described as induced by heavy metals. Surprisingly, sigma(F) itself is not strongly auto-regulated under metal stress conditions. Interestingly, sigma(F)-dependent genes are not induced in the presence of agents that generate reactive oxygen species. Promoter analyses revealed that a conserved sigma(F)-dependent sequence is located upstream of all genes of the sigma(F) regulon. In addition, we show that the second gene in the sigF operon acts as a negative regulator of sigma(F) function, and the encoded protein has been named NrsF (Negative regulator of sigma F). Substitution of two conserved cysteine residues (C131 and C181) in NrsF affects its ability to maintain the expression of sigma(F)-dependent genes at basal levels. Furthermore, we show that sigma(F) is released into the cytoplasm during chromium stress and in cells carrying point mutations in both conserved cysteines of the protein NrsF. Conclusion: A possible mechanism for induction of the sigma(F)-dependent genes by chromium and cadmium is the inactivation of the putative anti-sigma factor NrsF, leading to the release of sigma(F) to bind RNA polymerase core and drive transcription of its regulon.
Resumo:
Background The α-proteobacterium Caulobacter crescentus inhabits low-nutrient environments and can tolerate certain levels of heavy metals in these sites. It has been reported that C. crescentus responds to exposure to various heavy metals by altering the expression of a large number of genes. Results In this work, we show that the ECF sigma factor σF is one of the regulatory proteins involved in the control of the transcriptional response to chromium and cadmium. Microarray experiments indicate that σF controls eight genes during chromium stress, most of which were previously described as induced by heavy metals. Surprisingly, σF itself is not strongly auto-regulated under metal stress conditions. Interestingly, σF-dependent genes are not induced in the presence of agents that generate reactive oxygen species. Promoter analyses revealed that a conserved σF-dependent sequence is located upstream of all genes of the σF regulon. In addition, we show that the second gene in the sigF operon acts as a negative regulator of σF function, and the encoded protein has been named NrsF (Negative regulator of sigma F). Substitution of two conserved cysteine residues (C131 and C181) in NrsF affects its ability to maintain the expression of σF-dependent genes at basal levels. Furthermore, we show that σF is released into the cytoplasm during chromium stress and in cells carrying point mutations in both conserved cysteines of the protein NrsF. Conclusion A possible mechanism for induction of the σF-dependent genes by chromium and cadmium is the inactivation of the putative anti-sigma factor NrsF, leading to the release of σF to bind RNA polymerase core and drive transcription of its regulon.
Collagen response and glycoprotein VI function decline progressively as canine platelets age in vivo
Resumo:
Clinical and experimental observations suggest that platelet function deteriorates quickly with cell age. However, efforts to define age-dependent alterations have detected only modest biochemical changes occurring late in the cell life span. In this report, we demonstrate two significant alterations of the collagen response occurring during in vivo aging of canine platelets: a progressive increase in the EC50 for collagen types I, III and V and the emergence of a population of aged platelets which are refractory to collagen. Experiments with convulxin, a specific agonist for the collagen receptor glycoprotein VI (GPVI), also demonstrate an age-dependent decline in activation and the appearance of a non-reactive, aged population as observed with native collagens. Our studies indicate that canine platelets have two distinct binding levels for FITC-labeled convulxin and that the higher binding level disappears upon cell aging. During these studies one dog (#428) was identified whose platelets not only failed to demonstrate an age-dependent decrease in convulxin reactivity but also maintained a high convulxin-binding ability throughout their otherwise normal life span. Transfusion of biotinylated platelets from control dogs into dog #428 showed that the expected changes in collagen response and GPVI function did not occur in the transfused platelets. These observations demonstrate that the canine platelet response towards collagen is strongly dependent upon cell-age and suggest that this functional decline is at least partly due to an extrinsic-mediated alteration, possibly proteolytic, of GPVI.