A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Leaf-, Panel- And Latex-expressed Sequenced Tags From The Rubber Tree (hevea Brasiliensis) Under Cold-stressed And Suboptimal Growing Conditions: The Development Of Gene-targeted Functional Markers For Stress Response.

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

An insight into the sialotranscriptome of the brown dog tick, Rhipicephalus sanguineus

Background: Rhipicephalus sanguineus, known as the brown dog tick, is a common ectoparasite of domestic dogs and can be found worldwide. R. sanguineus is recognized as the primary vector of the etiological agent of canine monocytic ehrlichiosis and canine babesiosis. Here we present the first description of a R. sanguineus salivary gland transcriptome by the production and analysis of 2,034 expressed sequence tags (EST) from two cDNA libraries, one consctructed using mRNA from dissected salivary glands from female ticks fed for 3-5 days (early to mid library, RsSGL1) and the another from ticks fed for 5 days (mid library, RsSGL2), identifying 1,024 clusters of related sequences. Results: Based on sequence similarities to nine different databases, we identified transcripts of genes that were further categorized according to function. The category of putative housekeeping genes contained similar to 56% of the sequences and had on average 2.49 ESTs per cluster, the secreted protein category contained 26.6% of the ESTs and had 2.47 EST's/clusters, while 15.3% of the ESTs, mostly singletons, were not classifiable, and were annotated as ""unknown function"". The secreted category included genes that coded for lipocalins, proteases inhibitors, disintegrins, metalloproteases, immunomodulatory and antiinflammatory proteins, as Evasins and Da-p36, as well as basic-tail and 18.3 kDa proteins, cement proteins, mucins, defensins and antimicrobial peptides. Comparison of the abundance of ESTs from similar contigs of the two salivary gland cDNA libraries allowed the identification of differentially expressed genes, such as genes coding for Evasins and a thrombin inhibitor, which were over expressed in the RsSGL1 (early to mid library) versus RsSGL2 (mid library), indicating their role in inhibition of inflammation at the tick feeding site from the very beginning of the blood meal. Conversely, sequences related to cement (64P), which function has been correlated with tick attachment, was largely expressed in the mid library. Conclusions: Our survey provided an insight into the R. sanguineus sialotranscriptome, which can assist the discovery of new targets for anti-tick vaccines, as well as help to identify pharmacologically active proteins.

A proteomic approach to identifying proteins differentially expressed in conidia and mycelium of the entomopathogenic fungus Metarhizium acridum

Metarhizium spp. is an important worldwide group of entomopathogenic fungi used as an interesting alternative to chemical insecticides in programs of agricultural pest and disease vector control. Metarhizium conidia are important in fungal propagation and also are responsible for host infection. Despite their importance, several aspects of conidial biology, including their proteome, are still unknown. We have established conidial and mycelial proteome reference maps for Metarhizium acridum using two-dimensional gel electrophoresis (2-DE) and matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF MS). In all, 1130 +/- 102 and 1200 +/- 97 protein spots were detected in ungerminated conidia and fast-growing mycelia, respectively. Comparison of the two protein-expression profiles reveled that only 35 % of the protein spots were common to both developmental stages. Out of 94 2-DE protein spots (65 from conidia, 25 from mycelia and two common to both) analyzed using mass spectrometry, seven proteins from conidia, 15 from mycelia and one common to both stages were identified. The identified protein spots exclusive to conidia contained sequences similar to known fungal stress-protector proteins (such as heat shock proteins (HSP) and 6-phosphogluconate dehydrogenase) plus the fungal allergen Alt a 7, actin and the enzyme cobalamin-independent methionine synthase. The identified protein spots exclusive to mycelia included proteins involved in several cell housekeeping biological processes. Three proteins (HSP 90, 6-phosphogluconate dehydrogenase and allergen Alt a 7) were present in spots in conidial and mycelial gels, but they differed in their locations on the two gels. (c) 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Expressed sequenced tags and new genes from the cattle tick, Boophilus microplus

We used the expressed sequenced tags (ESTs) approach to study the genome of the cattle tick Boophilus microplus. One hundred and forty-two of our 234 unique ESTs were from genes not previously identified from ticks, mites or any other arachnids. The largest class of identified ESTs (29%) was from genes involved in transcription and translation. Ninety-one ESTs (39% of all ESTs) did not match any sequences in international databases; some of these may be specific to ticks. Thirteen percent of our ESTs were from ribosomal proteins and two ESTs were for genes implicated in resistance to pesticides. (C) 1998 Chapman & Hall Ltd.

Analysis of Mouse Keratin 6a Regulatory Sequences in Transgenic Mice Reveals Constitutive, Tissue-Specific Expression by a Keratin 6a Minigene

The analysis of keratin 6 expression is complicated by the presence of multiple isoforms that are expressed constitutively in a number of internal stratified epithelia, in palmoplantar epidermis, and in the companion cell layer of the hair follicle. In addition, keratin 6 expression is inducible in interfollicular epidermis and the outer root sheath of the follicle, in response to wounding stimuli, phorbol esters, or retinoic acid. In order to establish the critical regions involved in the regulation of keratin 6a (the dominant isoform in mice), we generated transgenic mice with two different-sized mouse keratin 6a constructs containing either 1.3 kb or 0.12 kb of 5' flanking sequence linked to the lacZ reporter gene. Both constructs also contained the first intron and the 3' flanking sequence of mouse keratin 6a. Ectopic expression of either transgene was not observed. Double-label immunofluorescence analyses demonstrated expression of the reporter gene in keratin 6 expressing tissues, including the hair follicle, tongue, footpad, and nail bed, showing that both transgenes retained keratinocyte-specific expression. Quantitative analysis of beta -galactosidase activity verified that both the 1.3 and 0.12 kb keratin 6a promoter constructs produced similar levels of the reporter. Notably, both constructs were constitutively expressed in the outer root sheath and interfollicular epidermis in the absence of any activating stimulus, suggesting that they lack the regulatory elements that normally silence transcription in these cells. This study has revealed that a keratin 6a minigene contains critical cis elements that mediate tissue-specific expression and that the elements regulating keratin 6 induction lie distal to the 1.3 kb promoter region.

Estimating the potential refolding yield of recombinant proteins expressed as inclusion bodies

Recombinant protein production in bacteria is efficient except that insoluble inclusion bodies form when some gene sequences are expressed. Such proteins must undergo renaturation, which is an inefficient process due to protein aggregation on dilution from concentrated denaturant. In this study, the protein-protein interactions of eight distinct inclusion-body proteins are quantified, in different solution conditions, by measurement of protein second virial coefficients (SVCs). Protein solubility is shown to decrease as the SVC is reduced (i.e., as protein interactions become more attractive). Plots of SVC versus denaturant concentration demonstrate two clear groupings of proteins: a more aggregative group and a group having higher SVC and better solubility. A correlation of the measured SVC with protein molecular weight and hydropathicity, that is able to predict which group each of the eight proteins falls into, is presented. The inclusion of additives known to inhibit aggregation during renaturation improves solubility and increases the SVC of both protein groups. Furthermore, an estimate of maximum refolding yield (or solubility) using high-performance liquid chromatography was obtained for each protein tested, under different environmental conditions, enabling a relationship between yield and SVC to be demonstrated. Combined, the results enable an approximate estimation of the maximum refolding yield that is attainable for each of the eight proteins examined, under a selected chemical environment. Although the correlations must be tested with a far larger set of protein sequences, this work represents a significant move beyond empirical approaches for optimizing renaturation conditions. The approach moves toward the ideal of predicting maximum refolding yield using simple bioinformatic metrics that can be estimated from the gene sequence. Such a capability could potentially screen, in silico, those sequences suitable for expression in bacteria from those that must be expressed in more complex hosts. (C) 2004 Wiley Periodicals, Inc.

Novel gene containing multiple epidermal growth factor-like motifs transiently expressed in the papillae of the ascidian tadpole larvae

We have investigated molecular mechanisms of the embryonic development of an ascidian, a primitive chordate which shares features of both invertebrates and vertebrates, with a view to identifying genes involved in development and metamorphosis, We isolated 12 partial cDNA sequences which were expressed in a stage-specific manner using differential display, We report here the isolation of a full-length cDNA sequence for one of these genes which was specifically expressed during the tailbud and larval stages of ascidian development, This cDNA, 1213 bp in length, is predicted to encode a protein of 337 amino acids containing four epidermal growth factor (EGF)-like repeats and three novel cysteine-rich repeats, Characterization of its spatial expression pattern by in situ hybridisation in late tailbud and larval embryos demonstrated strong expression localised throughout the papillae and anteriormost trunk and weaker expression in the epidermis of the remainder of the embryo, As recent evidence indicates that the signal for metamorphosis originates in the anterior trunk region, these results suggest that this gene may have a role in signalling the initiation of metamorphosis. (C) 1997 Wiley-Liss, Inc.

Characterization of bovine transcripts preferentially expressed in testis and with a putative role in spermatogenesis

Although the number of genes known to be associated with bovine spermatogenesis has increased in the past few years, regulation of this biological process remains poorly understood. Therefore, discovery of new male fertility genetic markers is of great value for assisted selection in commercially important cattle breeds, e.g., Nelore, that have delayed reproductive maturation and low fertility rates. The objective of the present study was to identify sequences associated with spermatogenesis that could be used as fertility markers. With RT-PCR, the following five transcripts preferentially expressed in adult testis were detected: TET(656) detected only in adult testis; TET(868) and TET(515) expressed preferentially in adult testis but also detected in fetal gonads of both sexes; and TET(456) and TET(262). expressed primarily in the testis, but also present in very low amounts in somatic tissues. Based on their homologies and expression profiles, we inferred that they had putative roles in spermatogenesis. Detection of sequences differentially expressed in testis, ovary, or both, was a useful approach for identifying new genes related to bovine spermatogenesis. The data reported here contributed to discovery of gene pathways involved in bovine spermatogenesis, with potential for prediction of fertility. (C) 2011 Elsevier Inc. All rights reserved.

MUC13, a novel human cell surface mucin expressed by epithelial and hemopoietic cells

Transmembrane mucins are glycoproteins involved in barrier function in epithelial tissues. To identify novel transmembrane mucin genes, we performed a tblastn search of the GenBank(TM) EST data bases with a serine/ threonine-rich search string, and a rodent gene expressed in bone marrow was identified. We determined the cDNA sequence of the human orthologue of this gene, MUC13, which localizes to chromosome band 3q13.3 and generates 3.2-kilobase pair transcripts encoding a 512-amino acid protein comprised of an N-terminal mucin repeat domain, three epidermal growth factor-like sequences, a SEA module, a transmembrane domain, and a cytoplasmic tail (GenBank(TM) accession no. AF286113), MUC13 mRNA is expressed most highly in the large intestine and trachea, and at moderate levels in the kidney, small intestine, appendix, and stomach, In situ hybridization in murine tissues revealed expression in intestinal epithelial and lymphoid cells. Immunohistochemistry demonstrated the human MUC13 protein on the apical membrane of both columnar and goblet cells in the gastrointestinal tract, as well as within goblet cell thecae, indicative of secretion in addition to presence on the cell surface. MUC13 is cleaved, and the beta -subunit containing the cytoplasmic tail undergoes homodimerization, Including MUC13, there are at least five cell surface mucins expressed in the gastrointestinal tract.

Cloning of a differentially expressed tropomyosin isoform from cultured rabbit aortic smooth muscle cells

The four known tropomyosin genes have highly conserved DNA and amino acid sequences, and at least 18 isoforms are generated by alternative RNA splicing in muscle and non-muscle cells. No rabbit tropomyosin nucleotide sequences are known, although protein sequences for alpha- and beta-tropomyosin expressed by rabbit skeletal muscle have been described. Subtractive hybridisation was used to select for genes differentially expressed in rabbit aortic smooth muscle cells (SMC), during the change in cell phenotype in primary culture that is characterised by a loss of cytoskeletal filaments and contractile proteins. This led to the cloning of a tropomyosin gene predominantly expressed in rabbit SMC during this change. The full-length cDNA clone, designated rabbit TM-beta, contains an open reading frame of 284 amino acids, 5' untranslated region (UTR) of I 17 base pairs and 3' UTR of 79 base pairs. It is closely related to the beta-gene isoforms in other species, with the highest homology in DNA and protein sequences to the human fibroblast isoform TM-1 (91.7% identity in 1035 bp and 93.3% identity in the entire 284 amino acid sequence of the protein), It differs from rabbit skeletal muscle P-tropomyosin (81.7% homology at the protein level) mainly in two regions at amino acids 189-213 and 258-283 suggesting alternative splicing of exons 6a for 6b and 9d for 9a. Since this TM-P gene was the only gene strongly enough expressed in SMC changing phenotype to be observed by the subtractive hybridisation screen, it likely plays a significant role in this process. (C) 2002 Published by Elsevier Science Ltd.

Ex vivo analysis of T-cell responses to Epstein-Barr virus-encoded oncogene latent membrane protein 1 reveals highly conserved epitope sequences in virus isolates from diverse geographic regions

Epstein-Barr virus (EBV)-encoded oncogene latent membrane protein (LMP) 1, which is consistently expressed in multiple EBV-associated malignancies, has been proposed as a potential target antigen for any future vaccine designed to control these malignancies. However, the high degree of genetic variation in the LMP1 sequence has been considered a major impediment for its use as a potential immunotherapeutic target for the treatment of EBV-associated malignancies. In the present study, we have employed a highly efficient strategy, based on ex vivo functional assays, to conduct an extensive sequence-wide analysis of LMP1-specific T-cell responses in a large panel of healthy virus carriers of diverse ethnic origin and nasopharyngeal carcinoma patients. By comparing the frequencies of T cells specific for overlapping peptides spanning LMP1, we mapped a number of novel HLA class I- and class II-restricted LMP1 T-cell epitopes, including an epitope with dual HLA class I restriction. More importantly, extensive sequence analysis of LMP1 revealed that the majority of the T-cell epitopes were highly conserved in EBV isolates from Caucasian, Papua New Guinean, African, and Southeast Asian populations, while unique geographically constrained genetic variation was observed within one HLA A2 supertype-restricted epitope. These findings indicate that conserved LMP1 epitopes should be considered in designing epitope-based immunotherapeutic strategies against EBV-associated malignancies in different ethnic populations.

Expression of the human carboxylesterase 2 enzyme (CES2) in mammalian cells

Dissertation to obtain a Master Degree in Biotechnology

Differentially expressed gene profile in the 6-hydroxy-dopamine-induced cell culture model of Parkinson's disease.

Parkinson's disease (PD) is a chronic neurodegenerative disorder characterized by progressive loss of dopaminergic (DA) neurons of the substantia nigra pars compacta with unknown aetiology. 6-Hydroxydopamine (6-OHDA) treatment of neuronal cells is an established in vivo model for mimicking the effect of oxidative stress found in PD brains. We examined the effects of 6-OHDA treatment on human neuroblastoma cells (SH-SY5Y) and primary mesencephalic cultures. Using a reverse arbitrarily primed polymerase chain reaction (RAP-PCR) approach we generated reproducible genetic fingerprints of differential expression levels in cell cultures treated with 6-OHDA. Of the resulting sequences, 23 showed considerable homology to known human coding sequences. The results of the RAP-PCR were validated by reverse transcription PCR, real-time PCR and, for selected genes, by Western blot analysis and immunofluorescence. In four cases, [tomoregulin-1 (TMEFF-1), collapsin response mediator protein 1 (CRMP-1), neurexin-1, and phosphoribosylaminoimidazole synthetase (GART)], a down-regulation of mRNA and protein levels was detected. Further studies will be necessary on the physiological role of the identified proteins and their impact on pathways leading to neurodegeneration in PD.

Sequencing and identification of expressed Schistosoma mansoni genes by random selection of cDNA clones from a directional library

We have initiated a gene discovery program in Schistosoma mansoni based on the technique of Expressed Sequence Tags (ESTs), i.e. partial sequences of cDNAs obtained from single passes in automatic DNA sequencers. ESTs can be used to identify genese onf the basis of their homology whith sequences from other species deposited in DNA or protein databases. Trasncripts with sequences without matches in teh databases may represent novel parasite-specific genes. This approach has shown to be very efficient and in less than two years a broad range of novel genes has already been ascertained, more than doubling the number of known S. mansoni genes.