Síntese, caracterização e cinética da decomposição térmica dos materiais cerâmicos PrMO3 (M = Ni ou Co)

In this work have been studied the preparation, characterization and kinetic study of decomposition of the polymerizing agent used in the synthesis under non-isothermal condition ceramics PrMO3 of general formula (M = Co and Ni). These materials were obtained starting from the respective metal nitrates, as a cations source, and making use of gelatin as polymerizing agent. The powders were calcined at temperatures of 500°C, 700°C and 900°C and characterized by X-ray Diffraction (XRD), Thermogravimetric Analysis (TG / DTG/ DTA), Infrared Spectroscopy (FTIR), Temperature Programmed Reduction (TPR) and Scanning Electron Microscopy (SEM). The perovskite phase was detected in all the X-rays patterns. In the infrared spectroscopy observed the oxide formation as the calcination temperature increases with the appearance of the band metal - oxygen. The images of SEM revealed uniform distribution for the PrCoO3 and particles agglomerated as consequence of particle size for PrNiO3. From the data of thermal analysis, the kinetics of decomposition of organic matter was employed using the kinetics methods called Model Free Kinetics and Flynn and Wall, in the heating ratios 10, 20 and 30° C.min-1 between room temperature and 700°C. Finally, been obtained the values of activation energy for the region of greatest decomposition of organic matter in samples that were determined by the degree of conversion (α)

Obtenção de óxidos a base de níquel e cobalto para reação de oxidação parcial do metano

Nickel-based catalysts supported on alumina have been widely used in various reactions to obtain synthesis gas or hydrogen. Usually, higher conversion levels are obtained by these catalysts, however, the deactivation by coke formation and sintering of metal particles are still problems to be solved. Several approaches have been employed in order to minimize these problems, among which stands out in recent years the use of additives such as oxides of alkali metals and rare earths. Similarly, the use of methodologies for the synthesis faster, easier, applicable on an industrial scale and to allow control of the microstructural characteristics of these catalysts, can together provide the solution to this problem. In this work, oxides with spinel type structure AB2O4, where A represents divalent cation and B represents trivalent cations are an important class of ceramic materials investigated worldwide in different fields of applications. The nickel cobaltite (NiCo2O4) was oxides of spinel type which has attracted considerable interest due to its applicability in several areas, such as chemical sensors, flat panel displays, optical limiters, electrode materials, pigments, electrocatalysis, electronic ceramics, among others. The catalyst precursor NiCo2O4 was prepared by a new chemical synthesis route using gelatine as directing agent. The polymer resin obtained was calcined at 350°C. The samples were calcined at different temperatures (550, 750 and 950°C) and characterized by X ray diffraction, measurements of specific surface area, temperature programmed reduction and scanning electron microscopy. The materials heat treated at 550 and 750°C were tested in the partial oxidation of methane. The set of techniques revealed, for solid preparations, the presence of the phase of spinel-type structure with the NiCo2O4 NixCo1-xO solid solution. This solid solution was identified by Rietveld refinement at all temperatures of heat treatment. The catalyst precursors calcined at 550 and 750°C showed conversion levels around 25 and 75%, respectively. The reason H2/CO was around 2 to the precursor treated at 750°C, proposed reason for the reaction of partial oxidation of methane, one can conclude that this material can be shown to produce synthesis gas suitable for use in the synthesis Fischer-Tropsch process

Síntese e caracterização de espinélios a base de Cu, Fe e Cr para pigmentos cerâmicos

Inorganic pigment comprises a host lattice, which is part of the chromophore component (usually a transition metal cation) and possible components modifiers, which stabilize, add or restate the properties pigments. Among the materials with spinel, ferrites, and the chromite stand out, because they have broad technological importance in the area of materials, applicability, pigments, catalytic hydrogenation, thin film, ceramic tiles, among others. The present work, pigments containing CuFe2O4, CuCr2O4,e CuFeCrO4, were synthesized by a method that makes use of gelatin as organic precursor using their application to ceramic pigments. The pigments were characterized by X-ray diffraction (XRD), Infrared spectroscopy, scanning electron microscopy (SEM) spectroscopy in the UV-visible and Colorimetry. The results confirmed the feasibility of the synthetic route used, with respect to powders synthesized, there is the formation of spinel phase from 500°C, with an increase in crystallinity and the formation of other phases. The pigments were shown to be crystalline and the desired phases were obtained. The copper chromite have hues ranging from green to black according to the calcination temperature, while the copper chromite doped with iron had brownish. The ferrites showed copper color and darker brown to black, which may indicate an interesting factor because of the importance of black pigment

Síntese e caracterização de cerâmicas nanométricas para produção de gás de síntese

In this work, ceramic powders belonging to the system Nd2-xSrxNiO4 (x = 0, 0.4, 0.8, 1.2 and 1.6) were synthesized for their use as catalysts to syngas production partial. It was used a synthesis route, relatively new, which makes use of gelatin as organic precursor. The powders were analyzed at several temperatures in order to obtain the perovskite phase and characterized by several techniques such as thermal analysis, X-rays diffraction, Rietveld refinement method, specific surface area, scanning electron microscopy, energy dispersive spectroscopy of X-rays and temperature programmed reduction. The results obtained using these techniques confirmed the feasibility of the synthesis method employed to obtain nanosized particles. The powders were tested in differential catalytic conditions for dry reforming of methane (DRM) and partial oxidation of methane (POM), then, some systems were chosen for catalytic integrals test for (POM) indicating that the system Nd2-xSrxNiO4 for x = 0, 0.4 and 1.2 calcined at 900 °C exhibit catalytic activity on the investigated experimental conditions in this work without showing signs of deactivation

Preparação e caracterização de filmes cerâmicos para cátodos de células a combustível de óxido sólido

Alternative and clean energy generation research has been intensified in last decades. Among the alternatives, fuel cells are one of the most important. There are different types of fuel cells, among which stands out intermediate temperature solid oxide fuel cell (IT-SOFC) matter of the present work. For application as cathode on this type of devices, the ceramic Ba0.5Sr0.5C0.8Fe0.2O3-δ doped with rare earth ions (Nd, Sm) have been quite promising because they show good ionic conductivity and operate at relatively low temperatures (500 - 800°C). In this work, Ba0.5Sr0.5Co0.8Fe0.2O3-δ, (BaSr)0.5Sm0.5Co0.8Fe0.2O3-δ and (BaSr)0.5Nd0.5C0.8Fe0.2O3-δ were obtained by modified Pechini method, making use of gelatin as polymerizing agent. The powders were characterized by X-Ray Diffraction (XRD), Temperature Programmed Reduction (TPR) and Scanning Electron Microscopy (SEM). The perovskite phase was observed in all X-ray patterns for the materials Ba0.5Sr0.5C0.8Fe0.2O3-δ doped with rare earth ions (Nd, Sm). The SEM images showed that the materials have a characteristics porous, with very uniform pore distribution, which are favorable for application as cathodes. Subsequently, screen-printed assymmetrical cells were studied by impedance spectroscopy, to assess the kinetics of the cathode for the reduction reaction of oxygen. The best resistance to the specific area was found for the cathode BSSCF sintered at 1050 °C for 4 hours with around 0.15 Ω.cm2 at 750 °C as well as cathodes BSNCF and BSCF obtained resistances specific area of 0.2 and 0.73 Ω.cm2, respectively, for the same conditions. The polarization curves showed similar behavior to the best cathodes BSSCF and BSNCF, such combination of properties indicates that the film potentially depict good performance as IT-SOFC cathodes

Revestimento de sementes de milho superdoce (sh2)

A semente de milho doce é leve e rugosa. A rugosidade torna difícil a classificação das sementes quanto à forma e ao tamanho e isso dificulta a semeadura. Uma solução para esse problema seria a utilização da técnica de revestimento. Assim, este trabalho teve por objetivo avaliar diferentes materiais de enchimento, cimentantes e corantes na peletização de sementes de milho superdoce e verificar quais combinações de materiais seriam eficientes na manutenção da qualidade fisiológica das sementes após o armazenamento e que permitissem vazão e distribuição uniformes durante a semeadura. Foram então testados doze materiais de enchimento (calcários 1 e 2, caulim, carvão vegetal ativado, areia, vermiculita, fubá de milho, farinha de trigo, polvilho de mandioca, amido de milho, celite e terra de diatomáceas), dois cimentantes (goma arábica e cascorez extra) e seis corantes (tintas guache, acrílica, plástica e para tecido, corante para alimento e gelatina). As avaliações da qualidade física e fisiológica das sementes revestidas e nuas foram efetuadas por meio dos testes: teor de água, fragmentação, peso de mil sementes, volume aparente e plantabilidade, germinação, primeira contagem da germinação e emergência de plântulas em campo. O revestimento de sementes de milho superdoce proporciona homogeneidade de forma e tamanho às sementes, melhora a vazão e a distribuição dos péletes na semeadura e não compromete a emergência de plântulas em campo depois de quatro meses de armazenamento.

Gestão logística e comércio exterior: um estudo de caso em uma empresa exportadora do setor de alimentos

The thesis argues the importance of the logistic management for the performance of the companies and for the foreign trade. The study is endorsed in construction of one analyses that brings in its essential the underlyng elements for the understanding of the subject. The analyse made from the data of an exporters company of Rio Grande of the Norte, with performance in the branch of candies, allowed to evaluate an efficient of the logistic management, that involving operacional and financial questions, is unavoidable for reduction of costs of the companies and has significant impact is its profitability

Estudo das interações polifenol-proteína e das reações de escurecimento não-enzimático para o processamento de cajuína

The cashew, a fruit from Brazilian Northeast is used to produce juice due to its flavor and vitamin C richness. However, its acceptance is limited due to its astringency. Cajuína is a derivate product appreciated by its characteristic flavor, freshness and lack of astringency, due to tannin removal. Cajuína is a light yellow beverage made from clarified cashew juice and sterilized after bottling. It differs from the integral and concentrated juice by the clarification and thermal treatment steps. Many problems such as haze and excessive browning could appear if these steps are not controlled. The objective of this work was divided into two stages with the aim to supply process information in order to obtain a good quality product with uniform characteristics (sensory and nutritional). Polyphenol-protein interaction was studied at the clarification step, which is an empirical process, to provide values on the amount of clarifying solution (gelatin) that must be added to achieve a complete juice clarification. Clarification essays were performed with juice dilutions of 1:2 and 1:10 and the effect of metabissulfite and tannic acid addition was evaluated. It was not possible to establish a clarification point. Metabissulfite did not influenced the clarification process however tannic acid addition displaced the clarification point, showing the difficulty visual monitoring of the process. Thermal treatment of clarified juice was studied at 88, 100, 111 e 121 °C. To evaluate the non-enzymatic browning, vitamin C, 5-hidroximetilfurfural (5-HMF) and sugar variation were correlated with color parameters (reflectance spectra, color difference and CIELAB). Kinetic models were obtained for reflectance spectra, ascorbic acid and 5-HMF. It was observed that 5-HMF introduction followed a first order kinetic rate at the beginning of the thermal treatment and a zero order kinetic at later process stages. An inverse correlation was observed between absorbance at 420 nm and ascorbic acid degradation, which indicates that ascorbic acid might be the principal factor on cajuína non-enzymatic browning. Constant sugar concentration showed that this parameter did not contribute directly to the nonenzymatic browning. Optimization techniques showed showed that to obtain a high vitamin C and a low 5-HMF content, the process must be done at 120 ºC. With the water-bath thermal treatment, the 90 °C temperature promoted a lower ascorbic acid degradation at the expense of a higher 5-HMF level

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Desenvolvimento de componentes nanométricos para aplicação em células a combustível à base de sólidos estruturados e filmes finos

The present work aims the preparation of filmes of strontium-doped lanthanum manganite (perovskita) yttria-stabilized zirconia (LSM-SDC) films deposited on substrate of YSZ by means of spin coating technique having as principal objective their application to solid oxide fuel cells of intermediate temperature. La0,8Sr0,2MnO3 and Ce0,8Sm0,2O1,9 were obtained by modified Pechini method by use of gelatin which act as polymerization agent. The powders obtained were characterized by Xray fluorescence, X ray diffraction, electronic scanning microscopy and the superficial area by BET method. The results obtained by X-ray fluorescence showed that the route adopted for obtention of powders was effective in the obtention of the compositions with close values to the stoichiometrics. Ethyl cellulose was used as pore-forming agent and mixed with the LSM-SDC powders in weight proportions of 1:24, 2:23 and 1:9. The films were sintered at 1150 °C for 4 h and characterized by X-ray diffraction and scanning electron microscopy technique (SEM) and atomic force. The phases quantification of the precursory powders and of the obtained films was carried through Rietveld method. According with the analysis of SEM, as the content of ethyl cellulose was increased, the pore distribution in films become more uniform and the pore size reduced. The methodology used for the obtention of the films was very efficient, considering a material was obtained with characteristics that were proper to the application as electrolyte/cathode system to solid oxide fuel cells

Partial characterization of proteolytic activity in Giardia duodenalis purified proteins

O presente estudo consiste em uma caracterização preliminar da atividade proteolítica de frações de proteínas purificadas a partir de lisados de trofozoítos de cepa isolada e axenizada no Brasil. Frações obtidas por cromatografia líquida (FPLC) foram analisadas quanto ao perfil eletroforético em géis de poliacrilamida (SDS-PAGE) e a atividade proteolítica foi avaliada em géis contendo gelatina como substrato. A caracterização das enzimas foi realizada a partir da análise do efeito de inibidores sintéticos de cisteína-proteases (E-64, IAA), serina-proteases (PMSF), serina e cisteína-proteases (TPCK, TLCK, elastatinal), metalo-proteases (EDTA) e aspartil proteases (pepstatina) sobre a degradação do substrato. Entre 30 frações eluídas, bandas de proteínas foram observadas em oito delas, entretanto, atividade proteolítica foi detectada apenas nas frações 23, 24, 25 e 26. O perfil eletroforético das proteínas revelou poucas bandas distribuídas na faixa de 45 a 18 kDa. Os zimogramas revelaram zonas de proteólise na faixa de aproximadamente 62 a 35 kDa, entretanto destacaram-se as bandas de hidrólise de 62, 55, 53, 50, 46 e 40 kDa. Nos ensaios de inibição, a proteólise foi marcantemente inibida por E-64, TPCK, TLCK e elastatinal. Redução discreta da proteólise foi observada com IAA e PMSF, enquanto que EDTA e pepstatina não promoveram alteração dos perfis de hidrólise. Estas observações são relevantes, especialmente se considerarmos que para elucidar o envolvimento das proteases na relação parasita-hospedeiro, a purificação dessas moléculas é um requisito importante.

Efeitos da idade e dos indicadores de obesidade na pressão arterial de trabalhadores

Os objetivos do estudo foram descrever a prevalência de hipertensão arterial (HA) e verificar os efeitos que a idade e indicadores de obesidade provocam na pressão arterial (PA) de trabalhadores de uma indústria de balas e gomas. Para tanto a PA sistólica (PAS), PA diastólica (PAD), as medidas de massa corporal (MC), estatura e circunferência de cintura (CC) foram obtidas de 348 trabalhadores voluntários (243 homens e 105 mulheres). A prevalência de HA na amostra foi 8,9% (31 casos) e mais comum nos homens do que nas mulheres (7,2% vs 1,7%). Entre os hipertensos a idade (PAS r=0,43) e a MC (PAD r=0,39) demonstraram correlação (r) positiva e significativa, apesar de baixa. Por sua vez entre os normotensos (317) e o grupo total (348), a idade e todos os indicadores de obesidade (MC, IMC, CC) apresentaram correlação baixa, porém significativa e positiva com os valores de PAS, PAD e PA média (PAM) (r=0,23 a r=0,47). Adicionalmente a análise estatística revelou que homens e mulheres com HA são mais velhos e obesos do que seus pares normotensos. Exceto para a idade e o sexo, que são fatores de risco não modificáveis, os indicadores de obesidade possuem forte associação com hábitos e comportamentos de risco e, portanto, passíveis de prevenção.

Isolation of Rhodocyclus gelatinosus from poultry slaughterhouse wastewater

Quatro culturas de bactérias fotossintetizantes isoladas de águas residuárias de abatedouro de aves foram identificadas como Rhodocyclus gelatinosus com base nas seguintes propriedades: desenvolvimento de cor avermelhada nos cultivos em meio sintético, motilidade positiva, morfologia de bastonetes gram-negativos ligeiramente curvos, atividade de liquefação da gelatina, utilização de citrato como fonte de carbono e produção de bacterioclorofila a e carotenóides da série espiriloxantina alternativa. Esses testes foram também aplicados para uma linhagem de Rhodocyclus gelatinosus de referência para efeito de comparação. A biomassa de R. gelatinosus pode representar uma fonte de nutrientes e de pigmentos na alimentação de aves.

Eletroanálise de corantes alimentícios: determinação de índigo carmim e tartrazina

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)