183 resultados para Transglutaminase


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Malária é uma doença parasitária infecciosa aguda ou crónica, causada pelo protozoário do género Plasmodium que é transmitido ao homem através de picada de mosquitos fêmeas do género Anopheles. Causa a morte a milhões de pessoas por ano, na sua maioria crianças até aos 5 anos de idade. A inexistência de estratégias eficazes, contra a transmissão da malária, deve-se sobretudo à falta de conhecimento de moléculas cruciais ao desenvolvimento do parasita no vector. Mecanismos de reconhecimento do parasita e a resposta imune do mosquito à infecção são claramente alvos de novas estratégias de controlo da malária. O ciclo natural de transmissão de Plasmodium requer a conclusão com sucesso, do ciclo esporogónico no intestino médio e nas glândulas salivares do mosquito Anopheles, um processo que demora cerca de duas semanas. Este processo de desenvolvimento pode ser bloqueado pelo sistema imune inato do mosquito, resultando assim na eliminação do parasita do vector. A resposta imunológica envolve vários mecanismos como a fagocitose, encapsulação, nodulação, síntese de péptidos antimicrobianos e coagulação, que são acompanhadas pela activação proteolítica da pró-fenoloxidase presente na hemolinfa.O sistema imune é um factor determinante da capacidade vectorial do mosquito, pelo que vários estudos têm sido feitos para melhor compreender as respostas do mosquito Anopheles, principal vector da malária, ao parasita Plasmodium. Uma das principais respostas desencadeadas pelo sistema imune do mosquito é a coagulação. Estudos recentes demonstram que a coagulação da hemolinfa de Anopheles requer actividade da fenoloxidase e difere de Drosophila s.p na formação, estrutura e composição. O objectivo deste trabalho é estudar o papel da coagulação na resposta do mosquito Anopheles gambiae ao parasita da malária Plasmodium berghei, através do estudo da transglutaminase. Para tal foi feita a caracterização dos genes que codificam para a transglutaminases em A. gambiae, através da sequenciação destes genes e dos seus transcritos, verificando-se alguns polimorfismos quando comparada com a sequência do genoma disponível na base de dados. Para caracterizar do papel desta enzima durante a infecção com P. berghei, foi feita a inibição da actividade enzimática dos genes AGAP009097 e AGAP009098 que codificam para a transglutaminases. Foi feita a descrição da dinâmica de transcrição durante a infecção e o silenciamento destes mesmos genes usando dsRNA. Observou-se um aumento da taxa de infecção e do número médio de oocistos por intestino médio nos mosquitos em que as transglutaminases foram inibidas quimicamente bem como naqueles que possuíam os genes silenciados, quando comparados com os grupos controlo. Com este trabalho espera-se ter contribuído para uma melhor compreensão do funcionamento da capacidade imunológica dos mosquitos na resposta ao parasita da malária e a possibilidade de manipular o sistema imune dos mesmos de modo a eliminar o parasita e contribuir para a diminuição/irradicação da malária, uma das principais doença e causa de morte a nível mundial.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fibrin has been long used clinically for hemostasis and sealing, yet extension of use in other applications has been limited due to its relatively rapid resorption in vivo, even with addition of aprotinin or other protease inhibitors. We report an engineered aprotinin variant that can be immobilized within fibrin and thus provide extended longevity. When recombinantly fused to a transglutaminase substrate domain from α(2)-plasmin inhibitor (α(2)PI(1-8)), the resulting variant, aprotinin-α(2)PI(1-8), was covalently crosslinked into fibrin matrices during normal thrombin/factor XIIIa-mediated polymerization. Challenge with physiological plasmin concentrations revealed that aprotinin-α(2)PI(1-8)-containing matrices retained 78% of their mass after 3 wk, whereas matrices containing wild type (WT) aprotinin degraded completely within 1 wk. Plasmin challenge of commercial sealants Omrixil and Tisseel, supplemented with aprotinin-α(2)PI(1-8) or WT aprotinin, showed extended longevity as well. When seeded with human dermal fibroblasts, aprotinin-α(2)PI(1-8)-supplemented matrices supported cell growth for at least 33% longer than those containing WT aprotinin. Subcutaneously implanted matrices containing aprotinin-α(2)PI(1-8) were detectable in mice for more than twice as long as those containing WT aprotinin. We conclude that our engineered recombinant aprotinin variant can confer extended longevity to fibrin matrices more effectively than WT aprotinin in vitro and in vivo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Limited data on a short series of patients suggest that lymphocytic enteritis (classically considered as latent coeliac disease) may produce symptoms of malabsorption, although the true prevalence of this situation is unknown. Serological markers of coeliac disease are of little diagnostic value in identifying these patients. Aims: To evaluate the usefulness of human leucocyte antigen-DQ2 genotyping followed by duodenal biopsy for the detection of gluten-sensitive enteropathy in first-degree relatives of patients with coeliac disease and to assess the clinical relevance of lymphocytic enteritis diagnosed with this screening strategy. Patients and methods: 221 first-degree relatives of 82 DQ2+ patients with coeliac disease were consecutively included. Duodenal biopsy (for histological examination and tissue transglutaminase antibody assay in culture supernatant) was carried out on all DQ2+ relatives. Clinical features, biochemical parameters and bone mineral density were recorded. Results: 130 relatives (58.8%) were DQ2+, showing the following histological stages: 64 (49.2%) Marsh 0; 32 (24.6%) Marsh I; 1 (0.8%) Marsh II; 13 (10.0%) Marsh III; 15.4% refused the biopsy. 49 relatives showed gluten sensitive enteropathy, 46 with histological abnormalities and 3 with Marsh 0 but positive tissue transglutaminase antibody in culture supernatant. Only 17 of 221 relatives had positive serological markers. Differences in the diagnostic yield between the proposed strategy and serology were significant (22.2% v 7.2%, p<0.001). Relatives with Marsh I and Marsh II¿III were more often symptomatic (56.3% and 53.8%, respectively) than relatives with normal mucosa (21.1%; p=0.002). Marsh I relatives had more severe abdominal pain (p=0.006), severe distension (p=0.047) and anaemia (p=0.038) than those with Marsh 0. The prevalence of abnormal bone mineral density was similar in relatives with Marsh I (37%) and Marsh III (44.4%). Conclusions: The high number of symptomatic patients with lymphocytic enteritis (Marsh I) supports the need for a strategy based on human leucocyte antigen-DQ2 genotyping followed by duodenal biopsy in relatives of patients with coeliac disease and modifies the current concept that villous atrophy is required to prescribe a gluten-free diet.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The process of epidermal differentiation involves proliferation, differentiation, migration and maturation of keratinocytes to form an impermeable barrier against water loss and outside environment. It is controlled by highly balanced regulatory machinery, involving many molecules that are still under investigation.Homeobox proteins are involved in body patterning and morphogenesis of organs and are studied as potentially good candidates to regulate this process. In the first project we investigated the role of a protein named HOP which belongs to a group of homeobox proteins. Even if HOP is a small protein almost completely composed of the homeodomain and without DNA binding capacity, it is considered as transcriptional regulator in different tissues. HOP interacts with serum response factor (SRF) and histone deacetylase type 2 (HDAC2). By microarray analysis we found that HOP expression increases in cultured human primary keratinocytes (NHK) which undergo calcium-induced differentiation. HOP protein was localized in granular layer of the epidermis of healthy individuals. Lack of HOP was demonstrated in psoriatic lesions, whereas a strong expression was demonstrated in the lesional skin of patients affected with lichen planus (LP). Since LP is characterized by hypergranulosis while psoriatic lesions by progressive lack of the granular layer, the obtained data indicated that HOP might have a potential function in granular layer of epidermis. To investigate HOP function, we inhibited its expression by using HOP specific StealthRNAi and we overexpressed HOP using lentiviral vectors in differentiating NHK. The conclusion of both experiments indicated that HOP positively regulates the expression of late differentiation markers, such as profilaggrin, loricrin and transglutaminase 1. The in vitro data were next confirmed in vivo using HOP knockout mouse model.The second part of my study involved analysis of mechanisms underlying the pathogenesis of epidermolytic hyperkeratosis (EHK). EHK is a genetic disorder characterized by erythema, skin blistering, keratinocyte hyperproliferation and hyperkeratosis. EHK is caused by mutations in keratin 1 or 10 (K1, K10) which are major structural proteins of differentiated keratinocytes and participate in the cellular scaffold formation. To investigate how the structural proteins carrying mutations alter cellular signaling, we established an in vitro model for EHK by overexpression of one of the most common K10 mutations reported so far (K10R156H), in primary human keratinocytes. In order to mimic the in vivo situation, mutated keratinocytes growing on silicone membranes were subjected to mechanical stretch. We observed strong collapse of KIF in K10R156H keratinocytes when subjected to stretch for 30 minutes. Our data demonstrated stronger activation of p38, a member of MAPK stress signaling pathways, in K10R156H when compared to control cells. We demonstrated also that K10R156H keratinocytes showed an induction of TNF-α and RANTES release in response to stretch.Taken together these studies characterize a novel regulator of epidermal differentiation - HOP and demonstrate new aspects implicated in the pathogenesis of EHK.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Celiac disease is a lifelong, gluten-sensitive, autoimmune-mediated chronic enteropathy, tightly associated with risk alleles at the HLA class II genes. Aims: This study was carried out as a part of the population-based Type 1 Diabetes Prediction and Prevention (DIPP) Project. The first aim was to study the natural history of celiac disease-associated antibodies before the diagnosis of celiac disease was made. The second aim was to describe when and in which order celiac disease-associated and type 1 diabetes-associated antibodies appeared in children with genetic risk for both diseases. Subjects and Methods: Antibodies against tissue transglutaminase (TGA) and other celiac disease-associated antibodies were measured in serum samples collected at 3- to 12-month intervals of children at genetic risk for celiac disease who participated in the DIPP project. Celiac disease was confirmed by duodenal biopsy. Type 1 diabetes-associated antibodies were measured in all samples that had been collected. Overt disease was diagnosed according to World Health Organization criteria. Follow-up continued until a diagnosis of type 1 diabetes or until the end of a defined follow-up period. Results: TGA appeared in children at genetic risk for celiac disease only after the first year of life, but anti-gliadin antibodies often emerged significantly earlier, at age 6 months. The data show that spontaneous disappearance of celiac disease-associated antibodies, transient or persisting, is a common phenomenon, at least in prepubertal children. In children with genetic susceptibility to type 1 diabetes and celiac disease, celiac disease-associated antibodies usually develop earlier than the type 1 diabetes-associated antibodies. Conclusions: The transient nature of celiac disease-associated antibodies emphasizes the significance of establishing seropositivity repeatedly in screening detected celiac disease before gastroscopy and duodenal biopsy are considered and emphasized the importance of duodenal biopsy for diagnosing celiac disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We investigated whether liver injury by dual exposure to ethanol and carbon tetrachloride (EtOH + CCl4) for 15 weeks would persist after hepatotoxic agents were removed (EtOH + CCl4/8wR). After 15 weeks of hepatic injury with ethanol (5.5%, m/v) and carbon tetrachloride (0.05, mL/kg, ip), 5 of 11 female Wistar rats were sacrificed. The other 6 rats were maintained for an additional 8 weeks without hepatotoxic agents. Ultrasonography showed increased liver echogenicity and dilation of portal vein caliber in both groups (EtOH + CCl4: 0.22 ± 0.01 cm, P < 0.001; EtOH + CCl4/8wR: 0.21 ± 0.02 cm, P < 0.01) vs control (0.16 ± 0.02 cm). Histopathology showed regenerative nodules in both experimental groups. Histomorphometry revealed increased fibrosis content in both groups (EtOH + CCl4: 12.6 ± 2.64%, P < 0.001; EtOH + CCl4/8wR: 10.4 ± 1.36%, P < 0.05) vs control (2.2 ± 1.21%). Collagen types I and III were increased in groups EtOH + CCl4 (collagen I: 2.5 ± 1.3%, P < 0.01; collagen III: 1.3 ± 0.2%, P < 0.05) and EtOH + CCl4/8wR (collagen I: 1.8 ± 0.06%, P < 0.05; collagen III: 1.5 ± 0.8%, P < 0.01) vs control (collagen I: 0.38 ± 0.11%; collagen III: 0.25 ± 0.06%). Tissue transglutaminase increased in both groups (EtOH + CCl4: 66.4 ± 8%, P < 0.01; EtOH + CCl4/8wR: 58.8 ± 21%, P < 0.01) vs control (7.9 ± 0.8%). Cirrhosis caused by the association of CCl4-EtOH remained for at least 8 weeks after removal of these hepatotoxic agents. Ultrasound images can be a useful tool to evaluate advanced hepatic alterations.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dentre os fatores que afetam a atividade da enzima transglutaminase, a temperatura de reação ou incubação é um fator determinante no grau de reticulação. Por outro lado, para a gelatina, tipicamente a rede estrutural polimérica é estabilizada por forças secundárias, sendo que a formação da matriz polimérica envolve um delicado balanço entre interações polímero-polímero e polímero-solvente, e este balanço é fortemente dependente do histórico térmico da solução. Desta forma, o objetivo deste trabalho foi avaliar o efeito da temperatura na reação de modificação enzimática em relação às propriedades funcionais dos filmes modificados à base de gelatina (propriedades mecânicas, de barreira ao vapor de água, solubilidade em água e parâmetros de cor dos filmes). Viscosidade aparente das soluções filmogênicas foram também avaliadas. Foram produzidos filmes denominados nativo (FN), modificado enzimaticamente (FME) e termicamente tratado (FC). De acordo com os resultados obtidos, observou-se que a temperatura de reação não afetou as propriedades mecânicas e a solubilidade dos diferentes filmes estudados. Por outro lado, filmes modificados enzimaticamente (FME) na temperatura de 50 °C apresentaram permeabilidade ao vapor de água significantemente inferior aos produzidos nas demais temperaturas e tratamentos (FN e FC). O tratamento térmico também provocou redução da permeabilidade ao vapor de água.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A eficiência da aplicação de filmes à base de proteínas de soro de leite foi avaliada em um sistema de embalagem que consistia em um pote plástico utilizando-se filmes de proteínas de soro de leite como fechamento superior. Pedaços de maçã foram embalados e armazenados à temperatura ambiente (25 °C) e sob refrigeração (10 °C). Os filmes proteicos à base de soro de leite foram obtidos por três procedimentos distintos: por desnaturação térmica; com a incorporação de ácido esteárico (0,5%, em massa); e por modificação enzimática utilizando-se a transglutaminase microbiana (10U/g proteína, ACTIVA TG-B ), a partir de uma formulação básica de 6,50% de proteína, 3,0% de plastificante (glicerol) e pH 7,0. A integridade dos filmes após embalagem e durante armazenamento foi observada, medindo-se as propriedades mecânicas dos filmes. A permeabilidade ao vapor d'água foi avaliada pela perda de massa, teor de umidade, e variação de textura dos pedaços de maçã. Os resultados indicaram que os filmes apresentam uma barreira moderada à umidade, apresentando diferença entre potes com e sem coberturas de filmes. A permeabilidade ao oxigênio foi conferida pelo escurecimento enzimático das maçãs pela ação da enzima polifenoxidase, apresentando diferença em relação ao das amostras acondicionadas em atmosfera modificada com gás N2.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Nos métodos tradicionais de elaboração de presunto cru usa-se o pernil suíno inteiro, diferentemente da metodologia proposta neste trabalho, que combinou desossa, adição de transglutaminase, massageamento e moldagem das peças previamente à secagem e maturação, objetivando reduzir o tempo de processamento do produto. Avaliaram-se os efeitos de dois teores de NaCl adicionados (T1 - 3,5% e T2 - 5%), sobre características físico-químicas e microbiológicas dos presuntos crus ao longo do processo, além da avaliação sensorial dos produtos finais. Os presuntos crus obtidos atenderam aos padrões físico-químicos e microbiológicos determinados na legislação brasileira e não foram encontradas diferenças significativas (p < 0,05) entre os tratamentos quanto aos parâmetros avaliados no decorrer do processo e no produto final, com exceção da perda de peso, que foi maior em T1 (39,74 ± 4,02%) do que em T2 (37,22 ± 2,96%). Os presuntos crus desenvolvidos apresentaram formato e espessura apropriados para o fatiamento, excelente aparência, aroma característico e um sabor considerado muito próximo ao dos presuntos crus tradicionais comumente encontrados no mercado brasileiro, obtendo em torno de 80% de aceitação pelos consumidores.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Microparticles obtained by complex coacervation were crosslinked with glutaraldehyde or with transglutaminase and dried using freeze drying or spray drying. Moist samples presented Encapsulation Efficiency (%EE) higher than 96%. The mean diameters ranged from 43.7 ± 3.4 to 96.4 ± 10.3 µm for moist samples, from 38.1 ± 5.36 to 65.2 ± 16.1 µm for dried samples, and from 62.5 ± 7.5 to 106.9 ± 26.1 µm for rehydrated microparticles. The integrity of the particles without crosslinking was maintained when freeze drying was used. After spray drying, only crosslinked samples were able to maintain the wall integrity. Microparticles had a round shape and in the case of dried samples rugged walls apparently without cracks were observed. Core distribution inside the particles was multinuclear and homogeneous and core release was evaluated using anhydrous ethanol. Moist particles crosslinked with glutaraldehyde at the concentration of 1.0 mM.g-1 protein (ptn), were more efficient with respect to the core retention compared to 0.1 mM.g-1 ptn or those crosslinked with transglutaminase (10 U.g-1 ptn). The drying processes had a strong influence on the core release profile reducing the amount released to all dry samples

Relevância:

10.00% 10.00%

Publicador:

Resumo:

La diapause embryonnaire se manifeste par un arrêt réversible du développement embryonnaire durant la période de préimplantation et induit un retard de l’implantation. Chez le vison américain, une diapause embryonnaire obligatoire caractérise chaque gestation. Si les mécanismes de contrôle de la diapause embryonnaire obligatoire chez cette espèce sont bien connus, le rôle utérin impliqué dans la réactivation de l’embryon demeure, quant à lui, encore inconnu. Le sujet de ce doctorat a consisté dans un premier temps à explorer l’environnement utérin à la sortie de la diapause embryonnaire afin de caractériser, dans un deuxième temps, les principaux acteurs utérins qui provoquent la réactivation de l’embryon. Nous avons effectué une analyse du transcriptome utérin à l’émergence de la diapause embryonnaire ce qui a permis de construire une librairie de 123 séquences d’ADNc utérines différentiellement exprimées à la réactivation de l’embryon et homologues à des séquences de gènes connues chez d’autres espèces. Ces gènes sont impliqués dans la régulation du métabolisme (25 %), de l’expression génique (21 %), de la transduction de signal (15 %), du cycle cellulaire (15 %), du transport (10 %) et de la structure cellulaire (9 %), reflétant ainsi d’importantes modifications utérines à la réactivation embryonnaire. Nous avons validé l’expression différentielle de dix gènes ainsi identifiés : GDF3 (growth and differentiation 3), ALCAM (activated leukocyte cell adhesion molecule), ADIPOR1 (adiponectin receptor 1), HMGN1 (high mobility group N1), TXNL1 (thioredoxin like 1), TGM2 (tissue transglutaminase 2), SPARC (secreted protein acidic rich in cystein), et trois gènes codant pour AZIN1 (antizyme inhibitor 1), ODC1 (ornithine decarboxylase 1) et SAT1 (spermidine/spermine N1-acetyltransferase), des enzymes impliquées dans la biosynthèse des polyamines. Le patron de l’expression spatio-temporel de SPARC et d’HMGN1 illustrent spécifiquement un remodelage tissulaire et de la chromatine au niveau utérin à la sortie de la diapause embryonnaire. Ayant mesuré une augmentation des concentrations utérines en polyamines à la reprise du développement embryonnaire, nous avons émis l’hypothèse que les polyamines seraient impliquées dans les événements menant à la sortie de la diapause. L’inhibition de la biosynthèse des polyamines par un traitement à l’ α-difluoromethylornithine (DFMO) a provoqué une diminution significative de la proliferation cellulaire dans les embryons à la réactivation, un retard du moment de l’implantation, mais n’a pas affecté le succès de la reproduction. De manière similaire, nous avons induit un état de dormance dans les cellules de trophoblaste de vison en présence DFMO dans le milieu de culture, et constaté que cet état était réversible. En conclusion, cette étude a non seulement ouvert de nouveaux horizons quant à la compréhension du rôle utérin dans les événements menant à la sortie de la diapause embryonnaire, mais a démontré pour la première fois, l’existence de facteurs utérins indispensables à la réactivation de l’embryon: les polyamines.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

La paroi vasculaire est composée de cellules endothéliales, de cellules musculaires lisses vasculaires et de fibroblastes qui sont entourés d’un réseau structuré et complexe de protéines, la matrice extracellulaire. Les interactions réciproques entre la matrice et les cellules sont nécessaires à la croissance, au développement et au remodelage. Or, différents contextes pathologiques entraînent la perturbation de ces interactions et sont la cause de différentes maladies. Au cours du vieillissement, la matrice extracellulaire des grosses artères élastiques est modifiée. Ainsi, les lamelles élastiques de la paroi vasculaire se fragmentent ou sont dégradées, en plus de calcifier. De même, l’accumulation de protéines plus rigides, comme le collagène, entraîne le développement de la fibrose. Ces modulations vont mener à l’augmentation de la rigidité artérielle et au développement de l’hypertension systolique isolée. En utilisant un modèle animal de calcification basé sur l’inhibition d’une protéine anti-calcifiante, la matrix Gla protein, avec la warfarine, nous avons étudié la séquence des événements impliqués dans le développement de l’hypertension systolique isolée. Nous avons observé l’activation précoce et transitoire de MMP-9, puis du TGF-ß, précédant la modulation phénotypique des cellules musculaires lisses vasculaires, la calcification et les changements hémodynamiques. L’inhibition des métalloprotéinases et du TGF-ß a permis de prévenir la calcification vasculaire. Nous avons également étudié le rôle joué par une enzyme de la matrice extracellulaire, la transglutaminase 2, dans le développement de la calcification associée à l’hypertension systolique isolée. À l’aide d’un nouvel inhibiteur de cette enzyme, qui a permis de prévenir la calcification, nous avons établi que la transglutaminase était un élément clé dans le processus pathologique. Ces travaux ont permis de démontré l’intérêt de nouvelles avenues thérapeutiques ciblant directement la matrice extracellulaire, particulièrement la MMP-9, le TGF-ß et la transglutaminase 2, dans la pathologie de l’hypertension systolique isolée.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Introducción: La enfermedad celiaca (EC) es una enfermedad autoinmune (EA) intestinal desencadenada por la ingesta de gluten. Por la falta de información de la presencia de EC en Latinoamérica (LA), nosotros investigamos la prevalencia de la enfermedad en esta región utilizando una revisión sistemática de la literatura y un meta-análisis. Métodos y resultados: Este trabajo fue realizado en dos fases: La primera, fue un estudio de corte transversal de 300 individuos Colombianos. La segunda, fue una revisión sistemática y una meta-regresión siguiendo las guías PRSIMA. Nuestros resultados ponen de manifiesto una falta de anti-transglutaminasa tisular (tTG) e IgA anti-endomisio (EMA) en la población Colombiana. En la revisión sistemática, 72 artículos cumplían con los criterios de selección, la prevalencia estimada de EC en LA fue de 0,46% a 0,64%, mientras que la prevalencia en familiares de primer grado fue de 5,5 a 5,6%, y en los pacientes con diabetes mellitus tipo 1 fue de 4,6% a 8,7% Conclusión: Nuestro estudio muestra que la prevalencia de EC en pacientes sanos de LA es similar a la notificada en la población europea.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

L'objectiu és millorar els gels de plasma porcí induïts per calor a pH àcid utilitzant transglutaminasa microbiana (MTGasa). El tractament millora textura i CRA dels gels a pH 5,5, però les millores no són suficients per recuperar les pèrdues degut a l'acidificació. L'estructura globular de les proteïnes dificulta l'atac enzimàtic. La reactivitat de l'enzim no millora amb l'addició de cisteïna a plasma amb MTGasa. El tractament del plasma amb MTGasa sota alta pressió (HP) millora la duresa dels gels. No obstant, la CRA només millora lleugerament. La duresa es pot incrementar mantenint les solucions de plasma pressuritzat sota refrigeració, encara que no millora la CRA. Es pot concloure que les pèrdues en la textura dels gels de plasma induïts per calor a pH àcid es poden recuperar parcialment tractant amb MTGasa, especialment afegint cisteïna o sota HP. Encara que la CRA només es veu lleugerament millorada en el segon cas.