Expression, purification, crystallization, and NMR studies of the helicase interaction domain of Escherichia coli DnaG primase

in Escherichia coli, the DnaG primase is the RNA polymerase that synthesizes RNA primers at replication forks. It is composed of three domains, a small N-terminal zinc-binding domain, a larger central domain responsible for RNA synthesis, and a C-terminal domain comprising residues 434-581 [DnaG(434-581)] that interact with the hexameric DnaB helicase. Presumably because of this interaction, it had not been possible previously to express the C-terminal domain in a stably transformed E coli strain. This problem was overcome by expression of DnaG(434-581) under control of tandem bacteriophage gimel-promoters, and the protein was purified in yields of 4-6 mg/L of culture and studied by NMR. A TOCSY spectrum of a 2 mM solution of the protein at pH 7.0, indicated that its structured core comprises residues 444-579. This was consistent with sequence conservation among most-closely related primases. Linewidths in a NOESY spectrum of a 0.5 mM sample in 10 mM phosphate, pH 6.05, 0.1 M NaCl, recorded at 36 degreesC, indicated the protein to be monomeric. Crystals of selenomethionine-substituted DnaG(434-581) obtained by the hanging-drop vapor-diffusion method were body-centered tetragonal, space group I4(1)22, with unit cell parameters a = b 142.2 Angstrom, c = 192.1 Angstrom, and diffracted beyond 2.7 Angstrom resolution with synchrotron radiation. (C) 2003 Elsevier Inc. All rights reserved.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Correlation between macular and retinal nerve fibre layer Fourier-domain OCT measurements and visual field loss in chiasmal compression

Purpose The aim of this study was to test the correlation between Fourier-domain (FD) optical coherence tomography (OCT) macular and retinal nerve fibre layer (RNFL) thickness and visual field (VF) loss on standard automated perimetry (SAP) in chiasmal compression. Methods A total of 35 eyes with permanent temporal VF defects and 35 controls underwent SAP and FD-OCT (3D OCT-1000; Topcon Corp.) examinations. Macular thickness measurements were averaged for the central area and for each quadrant and half of that area, whereas RNFL thickness was determined for six sectors around the optic disc. VF loss was estimated in six sectors of the VF and in the central 16 test points in the VF. The correlation between VF loss and OCT measurements was tested with Spearman`s correlation coefficients and with linear regression analysis. Results Macular and RNFL thickness parameters correlated strongly with SAP VF loss. Correlations were generally stronger between VF loss and quadrantic or hemianopic macular thickness than with sectoral RNFL thickness. For the macular parameters, we observed the strongest correlation between macular thickness in the inferonasal quadrant and VF loss in the superior temporal central quadrant (rho=0.78; P<0.001) whereas for the RNFL parameters the strongest correlation was observed between the superonasal optic disc sector and the central temporal VF defect (rho=0.60; P<0.001).

Giant protein kinases: Domain interactions and structural basis of autoregulation

The myosin-associated giant protein kinases twitchin and titin are composed predominantly of fibronectin- and immunoglobulin-like modules, We report the crystal structures of two autoinhibited twitchin kinase fragments, one from Aplysia and a larger fragment from Caenorhabditis elegans containing an additional C-terminal immunoglobulin-like domain, The structure of the longer fragment shoes that the immunoglobulin domain contacts the protein kinase domain on the opposite side from the catalytic cleft, laterally exposing potential myosin binding residues, Together, the structures reveal the cooperative interactions between the autoregulatory region and the residues from the catalytic domain involved in protein substrate binding, ATP binding, catalysis and the activation loop, and explain the differences between the observed autoinhibitory mechanism and the one found in the structure of calmodulin-dependent kinase I.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A computerized tomography scan method for calculating the hernia sac and abdominal cavity volume in complex large incisional hernia with loss of domain

Preoperative progressive pneumoperitoneum (PPP) is a safe and effective procedure in the treatment of large incisional hernia (size > 10 cm in width or length) with loss of domain (LIHLD). There is no consensus in the literature on the amount of gas that must be insufflated in a PPP program or even how long it should be maintained. We describe a technique for calculating the hernia sac volume (HSV) and abdominal cavity volume (ACV) based on abdominal computerized tomography (ACT) scanning that eliminates the need for subjective criteria for inclusion in a PPP program and shows the amount of gas that must be insufflated into the abdominal cavity in the PPP program. Our technique is indicated for all patients with large or recurrent incisional hernias evaluated by a senior surgeon with suspected LIHLD. We reviewed our experience from 2001 to 2008 of 23 consecutive hernia surgical procedures of LIHLD undergoing preoperative evaluation with CT scanning and PPP. An ACT was required in all patients with suspected LIHLD in order to determine HSV and ACV. The PPP was performed only if the volume ratio HSV/ACV (VR = HSV/ACV) was a parts per thousand yen25% (VR a parts per thousand yen 25%). We have performed this procedure on 23 patients, with a mean age of 55.6 years (range 31-83). There were 16 women and 7 men with an average age of 55.6 years (range 31-83), and a mean BMI of 38.5 kg/m(2) (range 23-55.2). Almost all patients (21 of 23 patients-91.30%) were overweight; 43.5% (10 patients) were severely obese (obese class III). The mean calculated volumes for ACV and HSV were 9,410 ml (range 6,060-19,230 ml) and 4,500 ml (range 1,850-6,600 ml), respectively. The PPP is performed by permanent catheter placed in a minor surgical procedure. The total amount of CO(2) insufflated ranged from 2,000 to 7,000 ml (mean 4,000 ml). Patients required a mean of 10 PPP sessions (range 4-18) to achieve the desired volume of gas (that is the same volume that was calculated for the hernia sac). Since PPP sessions were performed once a day, 4-18 days were needed for preoperative preparation with PPP. The mean VR was 36% (ranged from 26 to 73%). We conclude that ACT provides objective data for volume calculation of both hernia sac and abdominal cavity and also for estimation of the volume of gas that should be insufflated into the abdominal cavity in PPP.

Macromolecular assembly of polycystin-2 intracytosolic C-terminal domain

Mutations in PKD2 are responsible for approximately 15% of the autosomal dominant polycystic kidney disease cases. This gene encodes polycystin-2, a calcium-permeable cation channel whose C-terminal intracytosolic tail (PC2t) plays an important role in its interaction with a number of different proteins. In the present study, we have comprehensively evaluated the macromolecular assembly of PC2t homooligomer using a series of biophysical and biochemical analyses. Our studies, based on a new delimitation of PC2t, have revealed that it is capable of assembling as a homotetramer independently of any other portion of the molecule. Our data support this tetrameric arrangement in the presence and absence of calcium. Molecular dynamics simulations performed with a modified all-atoms structure-based model supported the PC2t tetrameric assembly, as well as how different populations are disposed in solution. The simulations demonstrated, indeed, that the best-scored structures are the ones compatible with a fourfold oligomeric state. These findings clarify the structural properties of PC2t domain and strongly support a homotetramer assembly of PC2.

Silencing of LRRC49 and THAP10 genes by bidirectional promoter hypermethylation is a frequent event in breast cancer

Previously we found that levels of LRRC49 (leucine rich repeat containing 49; FLJ20156) transcripts were elevated in ER-positive breast tumors compared with ER-negative breast tumors. The LRRC49 gene is located on chromosome 15q23 in close proximity to the THAP10 (THAP domain containing 10) gene. These two genes have a bidirectional organization being arranged head-to-head on opposite strands, possibly sharing the same promoter region. Analysis of the promoter region of this gene pair revealed the presence of potential estrogen response elements (EREs), suggesting the potential of this promoter to be under the control of estrogen. We used quantitative real-time PCR (qPCR) to evaluate the expression of LRRC49 and THAP10 in a series of 72 primary breast tumors, and found reduced LRRC49 and THAP10 expression in 61 and 46% of the primary breast tumors analyzed, respectively. In addition, the occurrence of LRRC49/THAP10 promoter hypermethylation was examined by methylation specific PCR (MSP) in a sub-group of the breast tumors. Hypermethylation was observed in 57.5% of the breast tumors analyzed, and the levels of mRNA expression of both genes were inversely correlated with promoter hypermethylation. We investigated the effects of 17 beta-estradiol on LRRC49 and THAP10 expression in MCF-7 breast cancer cells and found both transcripts to be up-regulated 2- to 3-fold upon 17 beta-estradiol treatment. Our results show that the transcripts of LRRC49/THAP10 bidirectional gene pair are co-regulated by estrogen and that hypermethylation of the bidirectional promoter region simultaneously silences both genes. Further studies will be necessary to elucidate the role of LRRC49/THAP10 down-regulation in breast cancer.

Application of inter simple sequence repeat (ISSR) markers to plant genetics

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Comparison of Fourier-Domain and Time-Domain Optical Coherence Tomography in the Detection of Band Atrophy of the Optic Nerve

PURPOSE: To compare the ability of Fourier-domain (FD) optical coherence tomography (3D OCT-1000; Top, con, Tokyo, Japan) and time domain (TD) OCT (Stratus; Carl Zeiss Meditec Inc, Dublin, California, USA) to detect axonal loss in eyes with band atrophy (BA) of the optic nerve. DESIGN: Cross-sectional study. METHODS: Thirty-six eyes from 36 patients with BA and temporal visual field (VF) defect from chiasmal compression and 36 normal eyes were studied. Subjects were submitted to standard automated perimetry and macular and retinal nerve fiber layer (RNFL) measurements were taken using 3D OCT-1000 and Stratus OCT. Receiver operating characteristic (ROC) curves were calculated for each parameter. Spearman correlation coefficients were obtained to evaluate the relationship between RNFL and macular thickness parameters and severity of VF loss. Measurements from the two devices were compared. RESULTS: Regardless of OCT device, all RNFL and macular thickness parameters were significantly lower in eyes with BA compared with normal eyes, but no statistically significant difference was found with regard to the area under the ROC curve. Structure-function relationships were also similar for the two devices. In both groups, RNFL and macular thickness measurements were generally and in some cases significantly smaller with 3D OCT-1000 than with Stratus OCT. CONCLUSIONS: The introduction of FD technology did not lead to better discrimination ability for detecting BA of the optic nerve compared with TD technology when using the software currently provided by the manufacturer. 3D OCT-1000 FD OCT RNFL and macular measurements were generally smaller than TD Stratus OCT measurements. Investigators should be aware of this fact when comparing measurements obtained with these two devices. (Am J Oplathalmol 2009;147: 56-63. (c) 2009 by Elsevier Inc. All rights reserved.)

Cognitive functioning in subjects with recent-onset psychosis from a low-middle-income environment: Multiple-domain deficits and longitudinal evaluation

Cognitive deficits are a key feature of recent-onset psychosis, but there is no consensus on whether such deficits are generalized or confined to specific domains. Besides, it is unclear whether cognitive deficits: a) are found in psychotic patients in samples from outside high-income countries; and b) whether they progress uniformly over time in schizophrenia and affective psychoses. We applied 12 tests organized into eight cognitive domains, comparing psychosis patients (n = 56, time from initial contact = 677.95+/-183.27 days) versus healthy controls (n = 70) recruited from the same area of Sao Paulo, Brazil. Longitudinal comparisons (digit span and verbal fluency) were conducted between a previous assessment of the subjects carried out at their psychosis onset, and the current follow-up evaluation. Psychosis patients differed significantly from controls on five domains, most prominently on verbal memory. Cognitive deficits remained detectable in separate comparisons of the schizophrenia subgroup and, to a lesser extent, the affective psychosis subjects against controls. Longitudinal comparisons indicated significant improvement in schizophrenia, affective psychoses, and control subjects, with no significant group-by-time interactions. Our results reinforce the view that there are generalized cognitive deficits in association with recent-onset psychoses, particularly of non-affective nature, which persist over time. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

Effect of Disease Severity and Optic Disc Size on Diagnostic Accuracy of RTVue Spectral Domain Optical Coherence Tomograph in Glaucoma

PURPOSE. To evaluate the effect of disease severity and optic disc size on the diagnostic accuracies of optic nerve head (ONH), retinal nerve fiber layer (RNFL), and macular parameters with RTVue (Optovue, Fremont, CA) spectral domain optical coherence tomography (SDOCT) in glaucoma. METHODS. 110 eyes of 62 normal subjects and 193 eyes of 136 glaucoma patients from the Diagnostic Innovations in Glaucoma Study underwent ONH, RNFL, and macular imaging with RTVue. Severity of glaucoma was based on visual field index (VFI) values from standard automated perimetry. Optic disc size was based on disc area measurement using the Heidelberg Retina Tomograph II (Heidelberg Engineering, Dossenheim, Germany). Influence of disease severity and disc size on the diagnostic accuracy of RTVue was evaluated by receiver operating characteristic (ROC) and logistic regression models. RESULTS. Areas under ROC curve (AUC) of all scanning areas increased (P < 0.05) as disease severity increased. For a VFI value of 99%, indicating early damage, AUCs for rim area, average RNLI thickness, and ganglion cell complex-root mean square were 0.693, 0.799, and 0.779, respectively. For a VFI of 70%, indicating severe damage, corresponding AUCs were 0.828, 0.985, and 0.992, respectively. Optic disc size did not influence the AUCs of any of the SDOCT scanning protocols of RTVue (P > 0.05). Sensitivity of the rim area increased and specificity decreased in large optic discs. CONCLUSIONS. Diagnostic accuracies of RTVue scanning protocols for glaucoma were significantly influenced by disease severity. Sensitivity of the rim area increased in large optic discs at the expense of specificity. (Invest Ophthalmol Vis Sci. 2011;92:1290-1296) DOI:10.1167/iovs.10-5516

Comparison of Different Spectral Domain Optical Coherence Tomography Scanning Areas for Glaucoma Diagnosis

Purpose: To evaluate retinal nerve fiber layer (RNFL), optic nerve head (ONH), and macular thickness measurements for glaucoma detection using the RTVue spectral domain optical coherence tomograph. Design: Diagnostic, case-control study. Participants: One hundred forty eyes of 106 glaucoma patients and 74 eyes of 40 healthy subjects from the Diagnostic Innovations in Glaucoma Study (DIGS). Methods: All patients underwent ocular imaging with the commercially available RTVue. Optic nerve head, RNFL thickness, and macular thickness scans were obtained during the same visit. Receiver operating characteristic (ROC) curves and sensitivities at fixed specificities (80% and 95%) were calculated for each parameter. Main Outcome Measures: Areas under the ROC curves (AUC) and sensitivities at fixed specificities of 80% and 95%. Results: The AUC for the RNFL parameter with best performance, inferior quadrant thickness, was significantly higher than that of the best-performing ONH parameter, inferior rim area (0.884 vs 0.812, respectively; P = 0.04). There was no difference between ROC curve areas of the best RNFL thickness parameters and the best inner macular thickness measurement, ganglion cell complex root mean square (ROC curve area = 0.870). Conclusions: The RTVue RNFL and inner retinal macular thickness measurements had good ability to detect eyes with glaucomatous visual field loss and performed significantly better than ONH parameters.

Effect of Disease Severity on the Performance of Cirrus Spectral-Domain OCT for Glaucoma Diagnosis

PURPOSE. To evaluate the effect of disease severity on the diagnostic accuracy of the Cirrus Optical Coherence Tomograph (Cirrus HD-OCT; Carl Zeiss Meditec, Inc., Dublin, CA) for glaucoma detection. METHODS. One hundred thirty-five glaucomatous eyes of 99 patients and 79 normal eyes of 47 control subjects were recruited from the longitudinal Diagnostic Innovations in Glaucoma Study (DIGS). The severity of the disease was graded based on the visual field index (VFI) from standard automated perimetry. Imaging of the retinal nerve fiber layer (RNFL) was obtained using the optic disc cube protocol available on the Cirrus HD-OCT. Pooled receiver operating characteristic (ROC) curves were initially obtained for each parameter of the Cirrus HD-OCT. The effect of disease severity on diagnostic performance was evaluated by fitting an ROC regression model, with VFI used as a covariate, and calculating the area under the ROC curve (AUCs) for different levels of disease severity. RESULTS. The largest pooled AUCs were for average thickness (0.892), inferior quadrant thickness (0.881), and superior quadrant thickness (0.874). Disease severity had a significant influence on the detection of glaucoma. For the average RNFL thickness parameter, AUCs were 0.962, 0.932, 0.886, and 0.822 for VFIs of 70%, 80%, 90%, and 100%, respectively. CONCLUSIONS. Disease severity had a significant effect on the diagnostic performance of the Cirrus HD-OCT and thus should be considered when interpreting results from this device and when considering the potential applications of this instrument for diagnosing glaucoma in the various clinical settings. (Invest Ophthalmol Vis Sci. 2010;51:4104-4109) DOI:10.1167/iovs.094716

Microduplication of the ICR2 Domain at Chromosome 11p15 and Familial Silver-Russell Syndrome

Silver-Russell syndrome (SRS) is characterized by severe intrauterine and postnatal growth retardation in association with a typical small triangular face and other variable features. Genetic and epigenetic disturbances are detected in about 50% of the patients. Most frequently, SRS is caused by altered gene expression on chromosome 11p15 due to hypomethylation of the telomeric imprinting center (ICR1) that is present in at least 40% of the patients. Maternally inherited duplications encompassing ICR1 and ICR2 domains at 11p15 were found in a few patients, and a microduplication restricted to ICR2 was described in a single SRS child. We report on a microduplication of the ICR2 domain encompassing the KCNQ1, KCNQ1OT1, and CDKN1C genes in a three-generation family: there were four instances of paternal transmissions of the microduplication from a single male uniformly resulting in normal offspring, and five maternal transmissions, via two clinically normal sisters, with all the children exhibiting SRS. This report provides confirmatory evidence that a microduplication restricted to the ICR2 domain results in SRS when maternally transmitted. (C) 2011 Wiley-Liss, Inc.