889 resultados para REPEATS
Resumo:
A polymorphism of the dopamine transporter gene (DAT1, 10-repeat) is associated with attention-deficit hyperactivity disorder (ADHD) and has been linked to an enhanced response to methylphenidate (MPH). One aspect of the attention deficit in ADHD includes a subtle inattention to left space, resembling that seen after right cerebral hemisphere damage. Since left-sided inattention in ADHD may resolve when treated with MPH, we asked whether left-sided inattention in ADHD was related to DAT1 genotype and the therapeutic efficacy of MPH. A total of 43 ADHD children and their parents were genotyped for the DAT1 30 variable number of tandem repeats polymorphism. The children performed the Landmark Test, a well-validated measure yielding a spatial attentional asymmetry index ( leftward to rightward attentional bias). Parents rated their child's response to MPH retrospectively using a three-point scale ( no, mediocre or very good response). Additionally, parents used a symptom checklist to rate behavior while on and off medication. A within-family control design determined whether asymmetry indices predicted biased transmission of 10-repeat parental DAT1 alleles and/or response to MPH. It was found that left-sided inattention predicted transmission of the 10-repeat allele from parents to probands and was associated with the severity of ADHD symptomatology. Children rated as achieving a very good response to MPH displayed left-sided inattention, while those rated as achieving a poorer response did not. Our results suggest a subgroup of children with ADHD for whom the 10-repeat DAT1 allele is associated with left-sided inattention. MPH may be most efficacious in this group because it ameliorates a DAT1-mediated hypodopaminergic state.
Resumo:
Background: The androgen receptor gene is located on the X chromosome with a polymorphic tract of CAG repeats that is inversely correlated to the receptor`s transactivation activity. A short CAG tract is associated with hyperandrogenic disorders. In women, one of the X chromosomes is inactivated and the X chromosome inactivation (XCI) pattern varies among tissues. Previous studies of hyperandrogenic disorders only evaluated XCI in leukocytes. Objective: To evaluate whether the XCI pattern in leukocytes could be extrapolated to those in hair bulbs. Material: A total of 58 healthy women were used for this study. DNA was extracted from leukocytes (n = 58 women) and pubic (n = 53 women) and scalp hair (n = 21 women). Methods: Hpa II digested and undigested DNA samples underwent fluorescence PCR GeneScan (R) analysis. Results: A significant and positive correlation of XCI was found between leukocytes and hair bulbs. However, individual comparisons showed that 13 and 19% of the women presented a different leukocyte XCI pattern in pubic hair and similar in leukocytes and hair bulbs of normal women indicating that leukocyte DNA is useful for XCI analysis. However, the XCI pattern could vary among tissues from the same subject, indicating that care should be taken when extrapolating individual leukocyte XCI patterns to other tissue. Copyright (C) 2010 S. Karger AG, Basel
Resumo:
We describe the mechanism of ribonuclease inhibition by ribonuclease inhibitor, a protein built of leucine-rich repeats, based on the crystal structure of the complex between the inhibitor and ribonuclease A. The structure was determined by molecular replacement and refined to an R(cryst) of 19.4% at 2.5 Angstrom resolution. Ribonuclease A binds to the concave region of the inhibitor protein comprising its parallel beta-sheet and loops. The inhibitor covers the ribonuclease active site and directly contacts several active-site residues. The inhibitor only partially mimics the RNase-nucleotide interaction and does not utilize the pi phosphate-binding pocket of ribonuclease A, where a sulfate ion remains bound. The 2550 Angstrom(2) of accessible surface area buried upon complex formation may be one of the major contributors to the extremely tight association (K-i = 5.9 x 10(-14) M). The interaction is predominantly electrostatic; there is a high chemical complementarity with 18 putative hydrogen bonds and salt links, but the shape complementarity is lower than in most other protein-protein complexes. Ribonuclease inhibitor changes its conformation upon complex formation; the conformational change is unusual in that it is a plastic reorganization of the entire structure without any obvious hinge and reflects the conformational flexibility of the structure of the inhibitor. There is a good agreement between the crystal structure and other biochemical studies of the interaction. The structure suggests that the conformational flexibility of RI and an unusually large contact area that compensates for a lower degree of complementarity may be the principal reasons for the ability of RI to potently inhibit diverse ribonucleases. However, the inhibition is lost with amphibian ribonucleases that have substituted most residues corresponding to inhibitor-binding residues in RNase A, and with bovine seminal ribonuclease that prevents inhibitor binding by forming a dimer. (C) 1996 Academic Press Limited
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.
Resumo:
Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Previously we found that levels of LRRC49 (leucine rich repeat containing 49; FLJ20156) transcripts were elevated in ER-positive breast tumors compared with ER-negative breast tumors. The LRRC49 gene is located on chromosome 15q23 in close proximity to the THAP10 (THAP domain containing 10) gene. These two genes have a bidirectional organization being arranged head-to-head on opposite strands, possibly sharing the same promoter region. Analysis of the promoter region of this gene pair revealed the presence of potential estrogen response elements (EREs), suggesting the potential of this promoter to be under the control of estrogen. We used quantitative real-time PCR (qPCR) to evaluate the expression of LRRC49 and THAP10 in a series of 72 primary breast tumors, and found reduced LRRC49 and THAP10 expression in 61 and 46% of the primary breast tumors analyzed, respectively. In addition, the occurrence of LRRC49/THAP10 promoter hypermethylation was examined by methylation specific PCR (MSP) in a sub-group of the breast tumors. Hypermethylation was observed in 57.5% of the breast tumors analyzed, and the levels of mRNA expression of both genes were inversely correlated with promoter hypermethylation. We investigated the effects of 17 beta-estradiol on LRRC49 and THAP10 expression in MCF-7 breast cancer cells and found both transcripts to be up-regulated 2- to 3-fold upon 17 beta-estradiol treatment. Our results show that the transcripts of LRRC49/THAP10 bidirectional gene pair are co-regulated by estrogen and that hypermethylation of the bidirectional promoter region simultaneously silences both genes. Further studies will be necessary to elucidate the role of LRRC49/THAP10 down-regulation in breast cancer.
Resumo:
Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.
Resumo:
We have investigated molecular mechanisms of the embryonic development of an ascidian, a primitive chordate which shares features of both invertebrates and vertebrates, with a view to identifying genes involved in development and metamorphosis, We isolated 12 partial cDNA sequences which were expressed in a stage-specific manner using differential display, We report here the isolation of a full-length cDNA sequence for one of these genes which was specifically expressed during the tailbud and larval stages of ascidian development, This cDNA, 1213 bp in length, is predicted to encode a protein of 337 amino acids containing four epidermal growth factor (EGF)-like repeats and three novel cysteine-rich repeats, Characterization of its spatial expression pattern by in situ hybridisation in late tailbud and larval embryos demonstrated strong expression localised throughout the papillae and anteriormost trunk and weaker expression in the epidermis of the remainder of the embryo, As recent evidence indicates that the signal for metamorphosis originates in the anterior trunk region, these results suggest that this gene may have a role in signalling the initiation of metamorphosis. (C) 1997 Wiley-Liss, Inc.
Resumo:
Objective: To investigate a possible association between a 3`UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients (DSM-IV criteria) and 479 healthy controls. The primers` sequence used were: 3`UTR-Forward: 5`TGT GGT GAT GGG AAC GGC CTG AG 3` and 3`UTR-Reverse: 5`CTT CCT GGA GGT CAC GGC TCA AGG 3`. Alleles of the 3`UTR were coded according to their number of repeats: 6- repeat 320 bp (allele 6), 8- repeat 400 bp (allele 8), 9-repeat 480 bp (allele 9), 10- repeat 480 bp (allele 10), and 11- repeat 520 bp (allele 11). Results: There were no allelic (chi(2) = 2.67, 5df, p = .75) and genotypic (chi(2) = 7.20, 1df, p = .61) association between adult ADHD and VNTR 3`UTR polymorphism of SLC6A3. Conclusion: Our findings do not support SLC6A3 as marker genetic susceptibility factor in adult ADHD. More comprehensive polymorphism coverage within the SLC6A3 region should be conducted in larger samples, including comparisons in clinical subgroups, and in samples with different ethnic backgrounds. (J. of Att. Dis. 2011; 15(4) 305-309)
Resumo:
Deletion of the long arm of chromosome 18 is one of the most common segmental aneusomies compatible with life and usually involves a deletion of the terminal chromosomal region. However, the mechanisms implicated in the stabilization of terminal deletions are not well understood. In this study, we analyzed a girl with moderate mental retardation who had a cytogenetically visible terminal 18q deletion. In order to characterize the breakpoint in the terminal 18q region, we used fluorescence In situ hybridization (FISH) with bacterial artificial chromosomes (BACs) and pan-telomeric probes and also the array technique based on comparative genomic hybridization (array-CGH). FISH with pan-telomeric probes revealed no signal in the terminal region of the deleted chromosome, indicating the absence of normal telomere repeat (TTAGGG)n sequences in 18q. We suggest that neo-telomere formation by chromosome healing was involved in the repair and stabilization of this terminal deletion. (C) 2010 Elsevier Masson SAS. All rights reserved.
Resumo:
Posttraumatic stress disorder (PTSD) is a prevalent, disabling anxiety disorder marked by behavioral and physiologic alterations which commonly follows a chronic course. Exposure to a traumatic event constitutes a necessary, but not sufficient, factor. There is evidence from twin studies supporting a significant genetic predisposition to PTSD. However, the precise genetic loci still remain unclear. The objective of the present study was to identify, in a case-control study, whether the brain-derived neurotrophic factor (BDNF) val66met polymorphism (rs6265), the dopamine transporter (DAT1) three prime untranslated region (3`UTR) variable number of tandem repeats (VNTR), and the serotonin transporter (5-HTTPRL) short/long variants are associated with the development of PTSD in a group of victims of urban violence. All polymorphisms were genotyped in 65 PTSD patients as well as in 34 victims of violence without PTSD and in a community control group (n = 335). We did not find a statistical significant difference between the BDNF val66met and 5-HTTPRL polymorphism and the traumatic phenotype. However, a statistical association was found between DAT1 3`UTR VNTR nine repeats and PTSD (OR = 1.82; 95% CI, 1.20-2.76). This preliminary result confirms previous reports supporting a susceptibility role for allele 9 and PTSD.
Resumo:
Pre-eclampsia (PE) is associated with decreased nitric oxide (NO) formation. However, no previous study has examined whether genetic variations in the endothelial NO synthase (eNOS) affect this alteration. We hypothesized that PE decreases NO formation depending on eNOS polymorphisms. We examined how three eNOS polymorphisms [T-786C, rs2070744; Glu298Asp, rs1799983; 27 bp variable number of tandem repeats (VNTR) in intron 4] affect plasma nitrite concentrations in 205 pregnant women [107 healthy pregnant (HP) and 98 PE]. Genotypes were determined and eNOS haplotypes were inferred using the PHASE 2.1 program. The plasma nitrite concentrations were determined using an ozone-based chemiluminescence assay. The Glu298Asp polymorphism had no effects on the plasma nitrite concentrations. Higher nitrite levels were found in HP women with the CC versus TT genotype for the T-786C polymorphism (277.9 +/- 19.5 versus 140.6 +/- 8.2 nM; P < 0.05). Lower nitrite levels were found in healthy women with the 4a4a versus 4b4b genotype for the VNTR polymorphism (95.1 +/- 3.3 versus 216.1 +/- 16.8 nM; P < 0.05). No effects of genotypes were found in PE women (all P > 0.05). The `C Glu b` haplotype was more frequent in the HP group than in the PE group (20 versus 5; P = 0.0044). This haplotype was associated with higher nitrite concentrations than the other haplotypes in healthy pregnancies (P < 0.05). No differences in nitrite concentrations were found among PE women with different eNOS haplotypes (P > 0.05). These findings indicate that eNOS polymorphisms affect endogenous NO formation in normal pregnancy, but not in PE, and that the `C Glu b` haplotype may protect against the development of PE by increasing endogenous NO formation.
Resumo:
From a genomic library enriched for GA/CA repeats, 15 highly polymorphic microsatellite markers were developed for Cariniana estrellensis, a tropical forest tree. The microsatellite loci were screened in 49 mature trees found between Pardo river and Mogi-Gua double dagger u river basins, in the state of So Paulo, Brazil. A total of 140 alleles were detected with an average of 9.33 alleles per locus. The expected heterozygosity ranged from 0.37 to 0.88. These loci showed a high probability of paternity exclusion. Additionally, 12 loci were effectively transferred to Cariniana legalis. High levels of polymorphism make the present SSR markers useful for population genetic studies.
Resumo:
Hemophilia A is an X-linked, inherited, bleeding disorder caused by the partial or total inactivity of the coagulation factor VIII (FVIII). Due to difficulties in the direct recognition of the disease-associated mutation in the F8 gene, indirect diagnosis using polymorphic markers located inside or close to the gene is used as an alternative for determining the segregation of the mutant gene within families and thus for detecting carrier individuals and/or assisting in prenatal diagnosis. This study characterizes the allelic and haplotype frequencies, genetic diversity, population differentiation and linkage disequilibrium of five microsatellites (F8Int1, F8Int13, F8Int22, F8Int25.3 and IKBKG) in samples of healthy individuals from Sao Paulo, Rio Grande do Sul and Pernambuco and of patients from Sao Paulo with haemophilia A to determine the degree of informativeness of these microsatellites for diagnostic purposes. The interpopulational diversity parameters highlight the differences among the analyzed population samples. Regional differences in allelic frequencies must be taken into account when conducting indirect diagnosis of haemophilia A. With the exception of IKBKG, all of the microsatellites presented high heterozygosity levels. Using the markers described, diagnosis was possible in 10 of 11 families. The F8Int22, F8Int1, F8Int13, F8Int25.3 and IKBKG microsatellites were informative in seven, six, five and two of the cases, respectively, demonstrating the effectiveness of using these microsatellites in prenatal diagnosis and in carrier identification in the Brazilian population.