Reaching C-Reactive Protein and Low-Density Lipoprotein Cholesterol Goals in Dyslipidemic Patients (from the Lipid Treatment Assessment Project [L-TAP] 2)

The purpose of the present substudy of the Lipid Treatment Assessment Project 2 was to assess dual C-reactive protein (CRP) and low-density lipoprotein (LDL) cholesterol goal attainment across a spectrum of low-, moderate-, and high-risk patients with dyslipidemia in 8 countries in North America, Latin America, Europe, and Asia. Of the 9,518 patients studied overall, 45% were women, 64% had hypertension, 31% had diabetes, 14% were current smokers, 60% were high risk, and 79% were taking a statin. The median CRP level was 1.5 mg/L (interquartile range 0.2 to 2.8). On multivariate analysis, higher CRP levels were associated with older age, female gender, hypertension, current smoking, greater body mass index, larger waist circumference, LDL cholesterol level, and triglyceride/high-density lipoprotein cholesterol ratio. In contrast, being from Asia or taking a statin was associated with lower levels. Across all risk groups, 59% of patients attained the CRP target of <2 mg/L, and 33% had <1 mg/L. Overall, 44% of patients attained both their National Cholesterol Education Program Adult Treatment Panel III LDL cholesterol target and a CRP level of <2 mg/L, but only 26% attained their LDL cholesterol target and a CRP level of <1 mg/L. In the very high-risk group with coronary heart disease and >= 2 risk factors, only 19% attained both their LDL cholesterol goal and a CRP level of <2 mg/L and 12% their LDL cholesterol goal and a CRP level of <1 mg/L. In conclusion, with current treatment, most dyslipidemic patients do not reach the dual CRP and LDL cholesterol goals. Smoking cessation, weight reduction, and the greater use of more potent statins at higher doses might be able to improve these outcomes. (C) 2011 Elsevier Inc. All rights reserved. (Am J Cardiol 2011;107:1639-1643)

Impact of clinical varicocele and testis size on seminal reactive oxygen species levels in a fertile population: a prospective controlled study

Objective: To investigate: 1) the impact of clinical varicocele on reactive oxygen species (ROS) levels in neat and washed semen in a proven fertile population; and 2) the correlation between ROS levels, testicular volume, and varicocele grade in the same population of fertile men. Design: Prospective controlled clinical study. Setting: Andrology laboratory at tertiary-care hospital. Patient(s): One hundred fourteen healthy fertile men (81 normal fertile and 33 fertile with clinical varicocele) and 30 infertile patients (control subjects). Intervention(s): Standard semen analysis and measurement of sperm ROS production. Main Outcome Measure(s): Seminal parameters, seminal ROS levels, seminal leukocyte levels, clinical varicocele, and testis size. Result(s): Thirty-three of the 11.4 (29%) fertile men had clinical varicocele (grade 1, n = 14; grade 2, n = 11; and grade 3, n = 8), and the remaining 81 (71%) had a normal physical examination. Levels of ROS and semen quality did not differ significantly between the fertile men with or without varicocele. No significant differences in ROS levels in neat and washed semen were observed compared with fertile men with grades 2 and 3 varicocele and with fertile men with varicocele grade 1. The ROS levels in neat and washed semen were not significantly correlated with varicocele grade in fertile men. No significant correlations between ROS levels and testis volume were observed between the fertile groups. Conclusion(s): The presence of clinical varicocele in fertile men is not associated with higher seminal ROS levels or abnormal semen parameters. Levels of ROS are not correlated with varicocele grade or testis volume in the same population of fertile men.

Three-dimensional model for multi-component reactive transport with variable density groundwater flow

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Variation of Patterns of Malocclusion by Site of Pharyngeal Obstruction in Children

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

SINGLE MEASUREMENTS OF C-REACTIVE PROTEIN AND DISEASE ACTIVITY SCORES ARE NOT PREDICTORS OF CAROTID ATHEROSCLEROSIS IN RHEUMATOID ARTHRITIS PATIENTS

Background: Although inflammation has a defined role in the pathogenesis of atherosclerosis, the link between rheumatoid arthritis (RA) parameters of disease activity and atherosclerotic findings are not defined. Objective: To investigate the association between subclinical carotid atherosclerosis and clinical/laboratorial parameters of RA systemic inflammatory activity. Methods: Seventy-one RA patients were consecutively selected and compared to 53 healthy controls. Smoking, diabetes and hypertension were excluded, as well as the use of statins or fibrates. B-mode carotid ultrasound was performed in all subjects. CRP, ESR and fibrinogen were determined in both groups. Clinical assessment of RA activity included DAS 28 and SDAI. Correlation between plaques and intima-media thickness (IMT) of common carotid arteries and inflammatory parameters was evaluated. Results: Carotid plaques were more prevalent in RA patients than in controls (14.1% vs. 1.9 %, p=0.02) and marginally increased IMT was observed (0.72 +/- 0.17 vs. 0.67 +/- 0.15mm, p=0.07). RA patients with plaques had older age (p=0.001) and increased IMT (p<0.001), but low SDAI (p=0.025) compared to those without plaques. RA patients with plaques had also longer disease duration, although this difference did not reach statistical significance (p=0.06). No significant correlations were found between IMT and ESR (p=0.80), CRP (p=0.75), fibrinogen (p=0.94), HAQ (p=0.89) and DAS 28 (p=0.13). Conclusions: Carotid atherosclerosis is more frequently detected in RA but its prevalence was not correlated with isolated inflammatory markers measurement or noncumulative activity scores. These findings reinforce the need to evaluate subclinical atherosclerosis in RA patients, and to find predictors of atherosclerotic lesions.

Most of the patients presenting myocardial infarction would not be eligible for intensive lipid-lowering based on clinical algorithms or plasma C-reactive protein

Objective: The study we assessed how often patients who are manifesting a myocardial infarction (MI) would not be considered candidates for intensive lipid-lowering therapy based on the current guidelines. Methods: In 355 consecutive patients manifesting ST elevation MI (STEMI), admission plasma C-reactive protein (CRP) was measured and Framingham risk score (FRS), PROCAM risk score, Reynolds risk score, ASSIGN risk score, QRISK, and SCORE algorithms were applied. Cardiac computed tomography and carotid ultrasound were performed to assess the coronary artery calcium score (CAC), carotid intima-media thickness (cIMT) and the presence of carotid plaques. Results: Less than 50% of STEMI patients would be identified as having high risk before the event by any of these algorithms. With the exception of FRS (9%), all other algorithms would assign low risk to about half of the enrolled patients. Plasma CRP was <1.0 mg/L in 70% and >2 mg/L in 14% of the patients. The average cIMT was 0.8 +/- 0.2 mm and only in 24% of patients was >= 1.0 mm. Carotid plaques were found in 74% of patients. CAC > 100 was found in 66% of patients. Adding CAC >100 plus the presence of carotid plaque, a high-risk condition would be identified in 100% of the patients using any of the above mentioned algorithms. Conclusion: More than half of patients manifesting STEMI would not be considered as candidates for intensive preventive therapy by the current clinical algorithms. The addition of anatomical parameters such as CAC and the presence of carotid plaques can substantially reduce the CVD risk underestimation. (C) 2010 Elsevier Ireland Ltd. All rights reserved.

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Structural analysis of three His32 mutants of DsbA: Support for an electrostatic role of His32 in DsbA stability

DsbA, a 21-kDa protein from Escherichia coli, is a potent oxidizing disulfide catalyst required for disulfide bond formation in secreted proteins. The active site of DsbA is similar to that of mammalian protein disulfide isomerases, and includes a reversible disulfide bond formed from cysteines separated by two residues (Cys3O-Pro31-His32-Cys33). Unlike most protein disulfides, the active-site disulfide of DsbA is highly reactive and the oxidized form of DsbA is much less stable than the reduced form at physiological pH. His32, one of the two residues between the active-site cysteines, is critical to the oxidizing power of DsbA and to the relative instability of the protein in the oxidized form. Mutation of this single residue to tyrosine, serine, or leucine results in a significant increase in stability (of similar to 5-7 kcal/mol) of the oxidized His32 variants relative to the oxidized wild-type protein. Despite the dramatic changes in stability, the structures of all three oxidized DsbA His32 Variants are very similar to the wild-type oxidized structure, including conservation of solvent atoms near the active-site residue, Cys3O. These results show that the His32 residue does not exert a conformational effect on the structure of DsbA. The destabilizing effect of His32 on oxidized DsbA is therefore most likely electrostatic in nature.

Bioactivation of Phenytoin by Human Cytochrome P450: Characterization of the Mechanism and Targets of Covalent Adduct Formation

The cytochrome P450-dependent covalent binding of radiolabel derived fi om phenytoin (DPH) and its phenol and catechol metabolites, 5-(4'-hydroxyphenyl)-5-phenylhydantoin (HPPH) and 5-(3',4'-dihydroxyphenyl)-5-phenylhydantoin (CAT), was examined in liver microsomes. Radiolabeled HPPH and CAT and unlabeled CAT were obtained from microsomal incubations and isolated by preparative HPLC. NADPH-dependent covalent binding was demonstrated in incubations of human liver microsomes with HPPH. When CAT was used as substrate, covalent adduct formation was independent of NADPH, was enhanced in the presence of systems generating reactive oxygen species, and was diminished under anaerobic conditions or in the presence of cytoprotective reducing agents. Fluorographic analysis showed that radiolabel derived from DPH and HPPH was selectively associated with proteins migrating with approximate relative molecular weights of 57-59 kDa and at the dye front (molecular weights < 23 kDa) on denaturing gels. Lower levels of radiolabel were distributed throughout the molecular weight range. In contrast, little selectivity was seen in covalent adducts formed from CAT. HPPH was shown to be a mechanism-based inactivator of P450, supporting the contention that a cytochrome P450 is one target of covalent binding. These results suggest that covalent binding of radiolabel derived from DPH in rat and human Liver microsomes occurs via initial P450-dependent catechol formation followed by spontaneous oxidation to quinone and semiquinone derivatives that ultimately react with microsomal protein. Targets for covalent binding may include P450s, though the catechol appears to be sufficiently stable to migrate out of the P450 active site to form adducts with other proteins. In conclusion, we have demonstrated that DPH can be bioactivated in human liver to metabolites capable of covalently binding to proteins. The relationship of adduct formation to DPH-induced hypersensitivity reactions remains to be clarified.

Consumption of fruits and vegetables and C - reactive protein in women undergoing cosmetic surgery

Low-grade inflammation adversely influences metabolism and cardiovascular prognosis, nevertheless increased intake of fruits and vegetables has rarely been studied in this context. Objective: In a prospective controlled study, the effect on C-reactive protein (CRP) levels was assessed. Methodology: Sixty consecutive women undergoing cosmetic abdominal surgery were instructed to consume six servings each of fruits and vegetables during the first postoperative month. Detailed 24h interviewer-administered dietary recall was conducted at baseline and at the end of the study, with weekly returns to monitor unscheduled dietary changes and compliance with the protocol. Variance (ANOVA) and covariance (ANCOVA) were evaluated to confirm significance and minimize confounding variables. Results: No differences concerning age (42.2 +/- 5.3 vs 41.1 +/- 6.0 years) or BMI (25.5 +/- 3.1 vs 25.0 +/- 3.0 kg/m(2)) occurred. Ingestion of fruits increased to approximately 5.2 vs 3.9 and of vegetables 5.9 vs 3.4 servings/ day, respectively. CRP decreased more conspicuously in the treated group (P = 0.028), and correlation between vitamin C input and CRP in supplemented participants was demonstrated (P = 0.014). Conclusions: Higher intake of antioxidant foods was feasible, and an antiinflammaotory effect occurred. Further studies with longer administration and follow-up period are recommended.

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Influence of Suture on Peripheral Nerve Regeneration and Collagen Production at the Site of Neurorrhaphy: An Experimental Study

BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.

Passive Acquisition of Protective Antibodies Reactive with Bordetella pertussis in Newborns via Placental Transfer and Breast-feeding

Although acquisition of anti-pertussis antibodies by the newborn via placental transfer has been demonstrated, a subsequent recrudescence of pertussis infection is often observed, particularly in infants. The present study investigated the passive transfer of anti-pertussis IgG and IgA antibodies to term newborns and their ability to neutralize bacterial pathogenicity in an in vivo experimental model using mice intracerebrally challenged with viable Bordetella pertussis. Forty paired samples of maternal/umbilical cord sera and colostrum were obtained. Anti-pertussis antibodies were analysed by immunoenzymatic assay and by Immunoblotting. Antibody neutralizing ability was assessed through intracerebral B. pertussis challenges in mice. Anti-pertussis IgG titres were equivalent in both maternal and newborn sera (medians = 1:225 and 1:265), with a transfer rate of 118%. The colostrum samples had variable specific IgA titres (median = 1:74). The immunoblotting assays demonstrated identical recognition profiles of paired maternal and newborn serum pools but different bacterial recognition intensities by colostrum pools. In the animal model, significant differences were always observed when the serum and colostrum samples and pools were compared with the positive control (P < 0.05). Unlike samples with lower anti-pertussis titres, samples with high titres showed protective capacities above 50%. Pertussis-absorbed serum and colostrum pools protected 30% of mice and purified IgG antibodies protected 65%. Both pooled and single-sample protective abilities were correlated with antibody titres (P < 0.01). Our data demonstrated the effectiveness of anti-pertussis antibodies in bacterial pathogenesis neutralization, emphasizing the importance of placental transfer and breast-feeding in protecting infants against respiratory infections caused by Bordetella pertussis.