Zn2SiO4/ZnO Core/Shell Coaxial Heterostructure Nanobelts Formed by an Epitaxial Growth

Si-doped ZnO can be synthesized on the surface of the early grown Zn2SiO4 nanostructures and form core/ shell coaxial heterostructure nanobelts with an epitaxial orientation relationship. A parallel interface with a periodicity array of edge dislocations and an inclined interface without dislocations can be formed. The visible green emission is predominant in PL spectra due to carrier localization by high density of deep traps from complexes of impurities and defects. Due to band tail localization induced by composition and defect fluctuation, and high density of free-carriers donated by doping, especially the further dissociation of excitons into free-carriers at high excitation intensity, the near-band-edge emission is dominated by the transition of free-electrons to free-holes, and furthermore, exhibits a significant excitation power-dependent red-shift characteristic. Due to the structure relaxation and the thermalization effects, carrier delocalization takes place in deep traps with increasing excitation density. As a result, the green emission passes through a maximum at 0.25I(0) excitation intensity, and the ratio of the violet to green emission increases monotonously as the excitation laser power density increases. The violet and green emission of ZnO nanostructures can be well tuned by a moderate doping and a variation in the excitation density.

Getting high-efficiency photoluminescence from Si nanocrystals in SiO2 matrix

Silicon nanocrystals in SiO2 matrix are fabricated by plasma enhanced chemical vapor deposition followed by thermal annealing. The structure and photoluminescence (PL) of the resulting films is investigated as a function of deposition temperature. Drastic improvement of PL efficiency up to 12% is achieved when the deposition temperature is reduced from 250 degreesC to room temperature. Low-temperature deposition is found to result in a high quality final structure of the films in which the silicon nanocrystals are nearly strain-free, and the Si/SiO2 interface sharp. The demonstration of the superior structural and optical properties of the films represents an important step towards the development of silicon-based light emitters. (C) 2002 American Institute of Physics.

Photoluminescence and Raman scattering of silicon nanocrystals prepared by silicon ion implantion into SiO2 films

Photoluminescence (PL) and Raman spectra of silicon nanocrystals prepared by Si ion implantion into SiO2 layers on Si substrate have been measured at room temperature. Their dependence on annealing temperature was investigated in detail. The PL peaks observed in the as-implanted sample originate from the defects in SiO2 layers caused by ion implantation. They actually disappear after thermal annealing at 800 degrees C. The PL peak from silicon nanocrystals was observed when thermal annealing temperatures are higher than 900 degrees C. The PL peak is redshifted to 1.7 eV and the intensity reaches maximum at the thermal annealing temperature of 1100 degrees C. The characterized Raman scattering peak of silicon nanocrystals was observed by using a right angle scattering configuration. The Raman signal related to the silicon nanocrystals appears only in the samples annealed at temperature above 900 degrees C. It further proves the formation of silicon nanocrystals in these samples. (C) 2000 American Institute of Physics. [S0021-8979(00)00215-2].

Optical properties of nanometer silicon prepared by silicon ion implanted into SiO2 layers

The samples of silicon nanocrystals (nc-Si) were prepared by Si ion implanted into SiO2 layers. Photoluminescence spectra were measured at room temperature and their dependence on thermal annealing was investigated. The experimental results show that PL peaks originate from the defects in SiO2 layers caused by ion implantation when the thermal annealing temperature is lower than 800 C. The PL peak from nc-Si was observed when the thermal annealing temperature was higher than 900 C, and PL intensity reached its maximum at the thermal annealing temperature of 1100 C. As the annealing temperature increases the red shift of PL peak from nc-Si shows the quantum size effect. The characterized Raman scattering peak of nc-Si was observed at the right angle scattering configuration for the first time. It provides further support for the PL measurements.

Fabrication of luminescent Ge nanocrystals started from unlayered hydrogenated amorphous SiGe films or hydrogenated amorphous Si hydrogenated amorphous Ge multilayers

Nanocrystalline Ge embedded in SiOx matrix is fabricated by oxidizing hydrogenated amorphous Sice alloys or hydrogenated amorphous Si/hydrogenated amorphous Ge multilayers. The structures before and after oxidation are systematically investigated. Visible light emission was observed from both samples. The luminescence peak is located at 2.2 eV which is independent of the starting materials. Compared to the luminescence from unlayered samples, the photoluminescence spectrum from multilayered samples has a narrower band width, which can be attributed to the uniform size distribution. The light emission origin is also discussed briefly and a mechanism different from the quantum size effect is suggested.

Microstructure and photoluminescence of a-SiOx : H

Two strong photoluminescence (PL) bands in the spectral range of 550-900 nm have been observed at room temperature from a series of a-SiOx:H films fabricated by plasma-enhanced chemical vapor deposition (PECVD) technique. One is composed of a main band in the red-light region and a shoulder; the other is located at about 850 nm, only found after 1170 degrees C annealing in N-2 atmosphere. In conjunction with infrared (IR) and micro-Raman spectra, it is thought that the two PL bands are associated with a-Si clusters in the SiOx network and nanocrystalline silicon in SiO2, respectively.

Annealing behaviors of photoluminescence from SiOx : H

The strong photoluminescence (PL) of SiOx:H prepared by plasma enhanced chemical vapor deposition has been systematically studied in conjunction with infrared and micro-Raman spectra. We have found that each PL spectrum is comprised of two Gaussian components, a main band and a shoulder. The main band might originate from amorphous silicon clusters embedded in die SiOx network, and its redshift with annealing temperature is due to expansion of the silicon clusters. The shoulder remains at about 835 nm in spite of the annealing temperature and possibly comes from luminescent defect centers. The enhanced PL spectra after 1170 degrees C annealing are attributed to the quantum confinement effects of nanocrystalline silicon embedded in the SiO2 matrix. (C) 1998 American Institute of Physics.

Photoluminescence from surface-oxidized Ge nanoclusters

Photoluminescence from gas-evaporated Ge nanoclusters consisting of a crystalline core encased in an oxide shell are presented. An as-grown sample shows room temperature luminescence with separate peaks around 357 and 580 nm. Prolonged air exposure of the clusters reduces the Ge core dimensions, and the emission initially at 580 nm shifts to 420 nm; however, the violet luminescence at 357 nm displays no difference. These results indicate that there are two mechanisms involved with light emission from Ge nanoclusters, visible light emission associated with the quantum confinement effect, and violet light emission correlated to luminescent centers. (C) 1998 Elsevier Science B.V.

A study of strong photoluminescence of SiOx : H films

We have examined photoluminescence (PL), IR absorption and Raman spectra of a series of hydrogenated amorphous silicon oxide (a-SiOx:H, (0 < x < 2)) films fabricated by plasma enhanced chemical vapor deposition (PECVD). Two strong luminescence bands were observed at room temperature, one is a broad envelope comprising a main peak around 670 nm and a shoulder at 835 nm, and the other, peaked around 850 nm; is found only after being annealed up to 1170 degrees C in N-2 environment. In conjunction with IR and Raman spectra, the origins of the two luminescent bands and their annealing behaviors are discussed on the basis of quantum confinement effects.

Quantum confinement effect in thin quantum wires

The electronic states and optical transition properties of three semiconductor wires Si? GaAs, and ZnSe are studied by the empirical pseudopotential homojunction model. The energy levels, wave functions, optical transition matrix elements, and lifetimes are obtained for wires of square cross section with width from 2 to 5 (root 2a/2), where a is the lattice constant. It is found that these three kinds of wires have different quantum confinement properties. For Si wires, the energy gap is pseudodirect, and the wave function of the electronic ground state consists mainly of four bulk Delta states. The optical transition matrix elements are much smaller than that of a direct transition, and increase with decreasing wire width. Where the width of wire is 7.7 Angstrom, the Si wire changes from an indirect energy gap to a direct energy gap due to mixing of the bulk Gamma(15) state. For GaAs wires. the energy gap is also pseudodirect in the width range considered, but the optical transition matrix elements are larger than those of Si wires by two orders of magnitude for the same width. However, there is no transfer to a direct energy gap as the wire width decreases. For ZnSe wires, the energy gap is always direct, and the optical transition matrix elements are comparable to those of the direct energy gap bulk semiconductors. They decrease with decreasing wire width due to mixing of the bulk Gamma(1) state with other states. All quantum confinement properties are discussed and explained by our theoretical model and the semiconductor energy band structures derived. The calculated lifetimes of the Si wire, and the positions of photoluminescence peaks, are in good agreement with experimental results.

Sol-gel derived Y2O3 as an efficient bluish-white phosphor without metal activator ions

In this paper, Y2O3 powder phosphors without metal activators were successfully prepared by the sol-gel method. The obtained sample shows an intense bluish-white emission (ranging from 350 to 600 nm, centered at 416 nm) under a wide range of UV light excitation (235-400 nm). The chromaticity coordinates of the sample are x = 0.159, y = 0.097, and the quantum yield is as high as 64.6%, which is a high value among the phosphor family without metal activators. The luminescent mechanisms have been ascribed to the carbon impurities in the Y2O3 host.

Phase transformation and photoluminescence properties of nanocrystalline ZrO2 powders prepared via the Pechini-type sol-gel process

Nanocrystalline ZrO2 fine powders were prepared via the Pechini-type sol-gel process followed by annealing from 500 to 1000 degrees C. The obtained ZrO2 samples were characterized by X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), electron paramagnetic resonance (EPR), and photoluminescence spectra (PL), respectively. The phase transition process from tetragonal (T) to monoclinic (M) was observed for the nanocrystalline ZrO2 powders in the annealing process, accompanied by the change of their photoluminescence properties. The 500 degrees C annealed ZrO2, powder with tetragonal structure shows an intense whitish blue emission (lambda(max) = 425 nm) with a wide range of excitation (230-400 nm). This emission decreased in intensity after being annealed at 600 degrees C (T + M-ZrO2) and disappeared at 700 (T + M-ZrO2), 800 (T + M-ZrO2), and 900 degrees C (M-ZrO2). After further annealing at 1000 degrees C (M-ZrO2), a strong blue-green emission appeared again (lambda(max) = 470 nm).

Synthesis of neodymium hydroxide nanotubes and nanorods by soft chemical process

A facile soft chemical approach using cetyltrimethylammoniurn bromide (CTAB) as template is successfully designed for synthesis of neodymium hydroxide nanotubes. These nanotubes have an average outer diameter around 20 nm, inner diameter around 2 nm, and length ranging from 100 to 120 nm, high BET surface area of 495.71 m(2) g(-1). We also find that neodymium hydroxide nanorods would be obtained when CTAB absented in reaction system. The Nd(OH)(3) nanorods might act as precursors that are converted into Nd2O3 nanorods through dehydration at 550 degrees C. The nanorods could exhibit upconversion emission characteristic under excitation of 591 nm at room temperature.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Decay of Cystalline Order and Equilibration during the Solid-to-Plasma Transition Induced by 20-fs Microfocused 92-eV Free-Electron-Laser Pulses

We have studied a solid-to-plasma transition by irradiating Al foils with the FLASH free electron laser at intensities up to 10(16) W/cm(2). Intense XUV self-emission shows spectral features that are consistent with emission from regions of high density, which go beyond single inner-shell photoionization of solids. Characteristic features of intrashell transitions allowed us to identify Auger heating of the electrons in the conduction band occurring immediately after the absorption of the XUV laser energy as the dominant mechanism. A simple model of a multicharge state inverse Auger effect is proposed to explain the target emission when the conduction band at solid density becomes more atomiclike as energy is transferred from the electrons to the ions. This allows one to determine, independent of plasma simulations, the electron temperature and density just after the decay of crystalline order and to characterize the early time evolution.