134 resultados para INTERLEUKINS


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Peer reviewed

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Assembly and mutual proximities of α, β, and γc subunits of the interleukin 2 receptors (IL-2R) in plasma membranes of Kit 225 K6 T lymphoma cells were investigated by fluorescence resonance energy transfer (FRET) using fluorescein isothiocyanate- and Cy3-conjugated monoclonal antibodies (mAbs) that were directed against the IL-2Rα, IL-2Rβ, and γc subunits of IL-2R. The cell-surface distribution of subunits was analyzed at the nanometer scale (2–10 nm) by FRET on a cell-by-cell basis. The cells were probed in resting phase and after coculture with saturating concentrations of IL-2, IL-7, and IL-15. FRET data from donor- and acceptor-labeled IL-2Rβ-α, γ-α, and γ-β pairs demonstrated close proximity of all subunits to each other in the plasma membrane of resting T cells. These mutual proximities do not appear to represent mAb-induced microaggregation, because FRET measurements with Fab fragments of the mAbs gave similar results. The relative proximities were meaningfully modulated by binding of IL-2, IL-7, and IL-15. Based on FRET analysis the topology of the three subunits at the surface of resting cells can be best described by a “triangular model” in the absence of added interleukins. IL-2 strengthens the bridges between the subunits, making the triangle more compact. IL-7 and IL-15 act in the opposite direction by opening the triangle possibly because they associate their private specific α receptors with the β and/or γc subunits of the IL-2R complex. These data suggest that IL-2R subunits are already colocalized in resting T cells and do not require cytokine-induced redistribution. This colocalization is significantly modulated by binding of relevant interleukins in a cytokine-specific manner.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Interleukin 16 (IL-16) has been shown to function as chemoattractant factor, as a modulator of T-cell activation, and as an inhibitor of immunodeficiency virus replication. The recent identification of inconsistencies in published IL-16 cDNA nucleotide sequences led to the proposal that IL-16 is synthesized in the form of a large precursor protein (pro-IL-16). To identify the true transcriptional start of the IL-16 mRNA rapid amplification of cDNA ends methods were applied. The complete pro-IL-16 cDNA was subsequently molecularly cloned, sequenced, and expressed in COS-7 cells. We report here that pro-IL-16 is most likely synthesized as a 67-kDa protein and is encoded from a major 2.6-kb transcript. Recombinant pro-IL-16 polypeptides are specifically cleaved in lysates of CD8(+) cells, suggesting that the naturally secreted bioactive form of IL-16 is smaller than the originally published 130 amino acids fragment. Moreover, in contrast to other interleukins such as IL-15, IL-16 mRNA expression is almost exclusively limited to lymphatic tissues underlining the potential of IL-16 as an immune regulatory molecule.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hematopoiesis gives rise to blood cells of different lineages throughout normal life. Abnormalities in this developmental program lead to blood cell diseases including leukemia. The establishment of a cell culture system for the clonal development of hematopoietic cells made it possible to discover proteins that regulate cell viability, multiplication and differentiation of different hematopoietic cell lineages, and the molecular basis of normal and abnormal blood cell development. These regulators include cytokines now called colony-stimulating factors (CSFs) and interleukins (ILs). There is a network of cytokine interactions, which has positive regulators such as CSFs and ILs and negative regulators such as transforming growth factor beta and tumor necrosis factor (TNF). This multigene cytokine network provides flexibility depending on which part of the network is activated and allows amplification of response to a particular stimulus. Malignancy can be suppressed in certain types of leukemic cells by inducing differentiation with cytokines that regulate normal hematopoiesis or with other compounds that use alternative differentiation pathways. This created the basis for the clinical use of differentiation therapy. The suppression of malignancy by inducing differentiation can bypass genetic abnormalities that give rise to malignancy. Different CSFs and ILs suppress programmed cell death (apoptosis) and induce cell multiplication and differentiation, and these processes of development are separately regulated. The same cytokines suppress apoptosis in normal and leukemic cells, including apoptosis induced by irradiation and cytotoxic cancer chemotherapeutic compounds. An excess of cytokines can increase leukemic cell resistance to cytotoxic therapy. The tumor suppressor gene wild-type p53 induces apoptosis that can also be suppressed by cytokines. The oncogene mutant p53 suppresses apoptosis. Hematopoietic cytokines such as granulocyte CSF are now used clinically to correct defects in hematopoiesis, including repair of chemotherapy-associated suppression of normal hematopoiesis in cancer patients, stimulation of normal granulocyte development in patients with infantile congenital agranulocytosis, and increase of hematopoietic precursors for blood cell transplantation. Treatments that decrease the level of apoptosis-suppressing cytokines and downregulate expression of mutant p53 and other apoptosis suppressing genes in cancer cells could improve cytotoxic cancer therapy. The basic studies on hematopoiesis and leukemia have thus provided new approaches to therapy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Interleukins 4 (IL-4) and 13 (IL-13) have been found previously to share receptor components on some cells, as revealed by receptor cross-competition studies. In the present study, the cloning is described of murine NR4, a previously unrecognized receptor identified on the basis of sequence similarity with members of the hemopoietin receptor family. mRNA encoding NR4 was found in a wide range of murine cells and tissues. By using transient expression in COS-7 cells, NR4 was found to encode the IL-13 receptor alpha chain, a low-affinity receptor capable of binding IL-13 but not IL-4 or interleukins 2, -7, -9, or -15. Stable expression of the IL-13 receptor alpha chain (NR4) in CTLL-2 cells resulted in the generation of high-affinity IL-13 receptors capable of transducing a proliferative signal in response to IL-13 and, moreover, led to competitive cross-reactivity in the binding of IL-4 and IL-13. These results suggest that the IL-13 receptor alpha chain (NR4) is the primary binding subunit of the IL-13 receptor and may also be a component of IL-4 receptors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Human T-cell-mediated autoimmune diseases are genetically linked to particular alleles of MHC class II genes. Susceptibility to pemphigus vulgaris (PV), an autoimmune disease of the skin, is linked to a rare subtype of HLA-DR4 (DRB1*0402, 1 of 22 known DR4 subtypes). The PV-linked DR4 subtype differs from a rheumatoid arthritis-associated DR4 subtype (DRB1*0404) only at three residues (DR beta 67, 70, and 71). The disease is caused by autoantibodies against desmoglein 3 (DG), and T cells are thought to trigger the autoantibody production against this keratinocyte adhesion molecule. Based on the DRB1*0402 binding motif, seven candidate peptides of the DG autoantigen were identified. T cells from four PV patients with active disease responded to one of these DG peptides (residues 190-204); two patients also responded to DG-(206-220). T-cell clones specific for DG-(190-204) secreted high levels of interleukins 4 and 10, indicating that they may be important in triggering the production of DG-specific autoantibodies. The DG-(190-204) peptide was presented by the disease-linked DRB1*0402 molecule but not by other DR4 subtypes. Site-directed mutagenesis of DRB1*0402 demonstrated that selective presentation of DG-(190-204), which carries a positive charge at the P4 position, was due to the negatively charged residues of the P4 pocket (DR beta 70 and 71). DR beta 71 has a negative charge in DRB1*0402 but a positive charge in other DR4 subtypes, including the DR4 subtypes linked to rheumatoid arthritis. The charge of the P4 pocket in the DR4 peptide binding site therefore appears to be a critical determinant of MHC-linked susceptibility to PV and rheumatoid arthritis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neurodegenerative processes in Alzheimer disease (AD) are thought to be driven in part by the deposition of amyloid beta (A beta), a 39- to 43-amino acid peptide product resulting from an alternative cleavage of amyloid precursor protein. Recent descriptions of in vitro neurotoxic effects of A beta support this hypothesis and suggest toxicity might be mediated by A beta-induced neuronal calcium disregulation. In addition, it has been reported that "aging" A beta results in increased toxic potency due to peptide aggregation and formation of a beta-sheet secondary structure. In addition, A beta might also promote neuropathology indirectly by activating immune/inflammatory pathways in affected areas of the brain (e.g., cortex and hippocampus). Here we report that A beta can modulate cytokine secretion [interleukins 6 and 8 (IL-6 and IL-8)] from human astrocytoma cells (U-373 MG). Freshly prepared and aged A beta modestly stimulated IL-6 and IL-8 secretion from U-373 MG cells. However, in the presence of interleukin-1 beta (IL-1 beta), aged, but not fresh, A beta markedly potentiated (3- to 8-fold) cytokine release. In contrast, aged A beta did not potentiate substance P (NK-1)- or histamine (H1)-stimulated cytokine production. Further studies showed that IL-1 beta-induced cytokine release was potentiated by A beta-(25-35), while A beta-(1-16) was inactive. Calcium disregulation may be responsible for the effects of A beta on cytokine production, since the calcium ionophore A23187 similarly potentiated IL-1 beta-induced cytokine secretion and EGTA treatment blocked either A beta or A23187 activity. Thus, chronic neurodegeneration in AD-affected brain regions may be mediated in part by the ability of A beta to exacerbate inflammatory pathways in a conformation-dependent manner.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Quiescent rat thymocytes were stimulated to divide by a variety of agents. One such mitogen was the neurotransmitter acetylcholine which exhibited a biphasic action. Interaction with low affinity nicotinic receptors was linked with an obligatory requirement for magnesium ions whereas combination with high affinity muscarinic receptors induced mitosis only if calcium ions were present in the medium. Binding of acetylcholine to its muscarinic receptor enhanced calcium influx and increased intracellular calcium levels causing calmodulin activation, a necessary prelude to DNA synthesis and mitosis. Nicotinic receptor activation may be associated with a magnesium influx and stimulation of cells in a calmodulin-independent fashion. Parathyroid hormone and its analogues exhibited only a monophasic mitogenic action. This response was linked to calcium influx, a rise in cytosolic calcium and calmodulin activation. Parathyroid hormone did not stimulate adenylate cyclase in thymocytes and decreased cellular cyclic AMP concentrations. Picomolar amounts of interleukin-2 (IL-2) also stimulated division in thymocytes derived from 3-month old rats by binding to high affinity receptors. The response in thymocytes from newborn and foetal animals was greater reflecting the larger proportion of cells bearing receptors at this age. The mitogenic effect of IL-2 was abolished by a monoclonal antibody directed against the IL-2 receptor. Injections of IL-2 itself or the administration of IL-2 secreting activated syngeneic spleen cells also stimulated proliferation of both thymus and bone marrow cells in vivo. Likewise immunisation with pertussis toxin, which enhances endogenous IL2 production, also increased mitosis in these tissues. Calcium influx, increased cytosolic Ca2+ levels and calmodulin activation are associated features of the mitogenic action of IL-2. Interleukin-1 was also found to be mitogenic in thymic lymphocyte cultures. The responses to this mitogen and to parathyroid hormone and acetylcholine were not inhibited by the anti-IL2 receptor antibody suggesting that the thymic lymphocyte bears discrete receptors for these agents. Subtle interactions of hormones, neurotransmitters and interleukins may thus contribute to the turnover and control of lymphoid cells in the thymus and perhaps bone-marrow.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective: The aim of the present study was to investigate if somatoform disorders (SFD) are associated with changes in the normal serum levels of important interleukins, and further, to establish if these changes are related to the presence and severity of alexithymia in patients with SFD. Methods: Twenty-four unmedicated patients who met the International Classification of Diseases (ICD-10) diagnostic criteria for SFD completed the psychological questionnaire to assess alexithymia (Toronto Alexithymia Scale), symptom reporting (SCL-90-R) and diagnostic criteria for SFD (Screening for Somatoform Symptoms scale). Serum concentrations of soluble interleukin 2 receptor α (sIL-2 Rα), IL-4, IL-6, IL-10 and IL-12 were determined in patients with SFD and in 9 healthy subjects. Results: In patients with SFD, serum levels of IL-6 (p < 0.001), IL-10 (p = 0.047) and immunoglobulin E (p = 0.045) were significantly increased in comparison with healthy controls. Additionally, a negative correlation was observed between the level of alexithymia ('total' Toronto Alexithymia Scale score) and the serum levels of sIL-2 Rα (r = -0.538) in SFD. Conclusions: Taken together, these results suggest that SFD, with clinically significant alexithymia, are associated with a reduction in Th1-mediated immune function and an increase in the activation of the Th2 immune function, indicated by the augmented serum levels of IL-6 and IL-10 and elevated immunoglobulin E. Copyright © 2007 S. Karger AG.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

During the last decades, it has been established that there is a relationship between major depression and activation of immune system. Nociceptin/orphanin FQ (N/OFQ) is the natural ligand of a Gi-protein coupled receptor named NOP, both compose the peptidergic system wich is involved in the regulation of mood states and inflammatory responses. Considering these actions, the present thesis aimed to investigate the consequences of blocking NOP signaling in lipopolysaccharide (LPS)-induced sickness and depressive-like behaviors in mice. Systemic administration of LPS doses, that do not cause sepsis in mice, induce changes in their behaviors related with activity of pro-inflammatory cytokines tumor necrosis factor-α (TNF-α) and interleukins 6 (IL-6) and 1β (IL-1 β). At the time points of 2 to 6 h and 24 h after intraperitoneal injection, mice treated with LPS displayed, respectively, sickness and depressive-like behaviors. In the present work the administration of LPS 0.8 mg/kg (ip) significantly induced sickness signs in Swiss and CD-1 mice, such as weight loss, transient reduction in rectal temperature and decrease of food and water intake. Moreover at 24 h after LPS injection these same mice strains displayed significantly increased immobility time on the tail suspension test (TST) when compared with control mice, this alteration was not related with possible locomotion impairments as verified on the open field test. Treatment with Nortriptyline 30 mg/kg (ip, 60 min prior the TST) reduced the immobility time of control and LPS-treated mice and was used as standard antidepressant. The NOP receptor antagonist SB-612111 (10 mg/kg, ip), 30 min prior LPS, did not modify LPS-induced sickness signs and depressive-like behavior. However, when injected 24 h after LPS treatment, SB-612111 (ip, 30 min prior the TST) as well as the peptidergic NOP receptor antagonist UFP-101 (10 nmol/2μL, icv, 5 min prior the TST) significantly reversed the toxin effects. The protocol of LPS-induced depressive-like states was also tested in NOP receptor knockout mice (NOP(-/-)) and their respective wild types (NOP(+/+)). LPS evoked transient rectal temperature reduction in NOP(-/-) mice and loss of body weight, food and water intake reduction in both NOP(+/+) and NOP(-/-) mice. The consumption of water was significantly different due to the genotype. LPS injection induced transient changes in pro-inflammatory cytokines. At 6 h after LPS injection, serum levels of TNF-α were significantly increased in NOP(+/+) and NOP(-/-) mice, as the IL-6 levels were significantly increased just in NOP(+/+) serum. At 24 h after LPS treatment the pro-inflammatory cytokines had returned to the baseline levels in both genotypes. LPS treatment elicited depressive-like effects in NOP(+/+) but not in NOP(-/-) mice. The data obtained during the execution of this doctoral thesis reveal that pharmacological and genetic blockade of NOP signaling does not affect LPS evoked sickness signs while reversing depressive-like behavior. In conclusion, these results highlight the involvement of the peptidergic system N/OFQ - NOP receptor in the modulation of behaviors related to mood and activation of the immune system.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND: Early-life reduction in nephron number (uninephrectomy [UNX]) and chronic high salt (HS) intake increase the risk of hypertension and chronic kidney disease. Adenosine signaling via its different receptors has been implicated in modulating renal, cardiovascular, and metabolic functions as well as inflammatory processes; however, the specific role of the A3 receptor in cardiovascular diseases is not clear. In this study, gene-modified mice were used to investigate the hypothesis that lack of A3 signaling prevents the development of hypertension and attenuates renal and cardiovascular injuries following UNX in combination with HS (UNX-HS) in mice. METHODS AND RESULTS: Wild-type (A3 (+/+)) mice subjected to UNX-HS developed hypertension compared with controls (mean arterial pressure 106±3 versus 82±3 mm Hg; P<0.05) and displayed an impaired metabolic phenotype (eg, increased adiposity, reduced glucose tolerance, hyperinsulinemia). These changes were associated with both cardiac hypertrophy and fibrosis together with renal injuries and proteinuria. All of these pathological hallmarks were significantly attenuated in the A3 (-/-) mice. Mechanistically, absence of A3 receptors protected from UNX-HS-associated increase in renal NADPH oxidase activity and Nox2 expression. In addition, circulating cytokines including interleukins 1β, 6, 12, and 10 were increased in A3 (+/+) following UNX-HS, but these cytokines were already elevated in naïve A3 (-/-) mice and did not change following UNX-HS. CONCLUSIONS: Reduction in nephron number combined with chronic HS intake is associated with oxidative stress, chronic inflammation, and development of hypertension in mice. Absence of adenosine A3 receptor signaling was strongly protective in this novel mouse model of renal and cardiovascular disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Congenital heart disease (CHD) is the most common birth defect, causing an important rate of morbidity and mortality. Treatment of CHD requires surgical correction in a significant percentage of cases which exposes patients to cardiac and end organ injury. Cardiac surgical procedures often require the utilisation of cardiopulmonary bypass (CPB), a system that replaces heart and lungs function by diverting circulation into an external circuit. The use of CPB can initiate potent inflammatory responses, in addition a proportion of procedures require a period of aortic cross clamp during which the heart is rendered ischaemic and is exposed to injury. High O2 concentrations are used during cardiac procedures and when circulation is re-established to the heart which had adjusted metabolically to ischaemia, further injury is caused in a process known as ischaemic reperfusion injury (IRI). Several strategies are in place in order to protect the heart during surgery, however injury is still caused, having detrimental effects in patients at short and long term. Remote ischaemic preconditioning (RIPC) is a technique proposed as a potential cardioprotective measure. It consists of exposing a remote tissue bed to brief episodes of ischaemia prior to surgery in order to activate protective pathways that would act during CPB, ischaemia and reperfusion. This study aimed to assess RIPC in paediatric patients requiring CHD surgical correction with a translational approach, integrating clinical outcome, marker analysis, cardiac function parameters and molecular mechanisms within the cardiac tissue. A prospective, single blinded, randomized, controlled trial was conducted applying a RIPC protocol to randomised patients through episodes of limb ischaemia on the day before surgery which was repeated right before the surgery started, after anaesthesia induction. Blood samples were obtained before surgery and at three post-operative time points from venous lines, additional pre and post-bypass blood samples were obtained from the right atrium. Myocardial tissue was resected during the ischaemic period of surgery. Echocardiographic images were obtained before the surgery started after anaesthetic induction and the day after surgery, images were stored for later off line analysis. PICU surveillance data was collected including ventilation parameters, inotrope use, standard laboratory analysis and six hourly blood gas analysis. Pre and post-operative quantitation of markers in blood specimens included cardiac troponin I (cTnI) and B-type natriuretic peptide (BNP), inflammatory mediators including interleukins IL-6, IL-8, IL-10, tumour necrosis factor (TNF-α), and the adhesion molecules ICAM-1 and VCAM-1; the renal marker Cystatin C and the cardiovascular markers asymmetric dymethylarginine (ADMA) and symmetric dymethylarginine (SDMA). Nitric oxide (NO) metabolites and cyclic guanosine monophosphate (cGMP) were measured before and after bypass. Myocardial tissue was processed at baseline and after incubation at hyperoxic concentration during four hours in order to mimic surgical conditions. Expression of genes involved in IRI and RIPC pathways was analysed including heat shock proteins (HSPs), toll like receptors (TLRs), transcription factors nuclear factor κ-B (NF- κ-B) and hypoxia inducible factor 1 (HIF-1). The participation of hydrogen sulfide enzymatic genes, apelin and its receptor were explored. There was no significant difference according to group allocation in any of the echocardiographic parameters. There was a tendency for higher cTnI values and inotropic score in control patients post-operatively, however this was not statistically significant. BNP presented no significant difference according to group allocation. Inflammatory parameters tended to be higher in the control group, however only TNF- α was significantly higher. There was no difference in levels of Cystatin C, NO metabolites, cGMP, ADMA or SDMA. RIPC patients required shorter PICU stay, all other clinical and laboratory analysis presented no difference related to the intervention. Gene expression analysis revealed interesting patterns before and after incubation. HSP-60 presented a lower expression at baseline in tissue corresponding to RIPC patients, no other differences were found. This study provided with valuable descriptive information on previously known and newly explored parameters in the study population. Demographic characteristics and the presence of cyanosis before surgery influenced patterns of activity in several parameters, numerous indicators were linked to the degree of injury suffered by the myocardium. RIPC did not reduce markers of cardiac injury or improved echocardiographic parameters and it did not have an effect on end organ function; some effects were seen in inflammatory responses and gene expression analysis. Nevertheless, an important clinical outcome indicator, PICU length of stay was reduced suggesting benefit from the intervention. Larger studies with more statistical power could determine if the tendency of lower injury and inflammatory markers linked to RIPC is real. The present results mostly support findings of larger multicentre trials which have reported no cardiac benefit from RIPC in paediatric cardiac surgery.