953 resultados para FACTOR G-CSF


Relevância:

90.00% 90.00%

Publicador:

Resumo:

The idiotype of the Ig expressed by a B-cell malignancy (Id) can serve as a unique tumor-specific antigen and as a model for cancer vaccine development. In murine models of Id vaccination, formulation of syngeneic Id with carrier proteins or adjuvants induces an anti-idiotypic antibody response. However, inducing a potent cell-mediated response to this weak antigen instead would be highly desirable. In the 38C13 lymphoma model, we observed that low doses of free granulocyte/macrophage colony-stimulating factor (GM-CSF) 10,000 units i.p. or locally s.c. daily for 4 days significantly enhanced protective antitumor immunity induced by s.c. Id-keyhole limpet hemocyanin (KLH) immunization. This effect was critically dependent upon effector CD4+ and CD8+ T cells and was not associated with any increased anti-idiotypic antibody production. Lymphocytes from spleens and draining lymph nodes of mice primed with Id-KLH plus GM-CSF, but not with Id-KLH alone, demonstrated significant proliferation to Id in vitro without any biased production of interferon gamma or interleukin 4 protein or mRNA. As a further demonstration of potency, 50% of mice immunized with Id-KLH plus GM-CSF on the same day as challenge with a large s.c. tumor inoculum remained tumor-free at day 80, compared with 17% for Id-KLH alone, when immunization was combined with cyclophosphamide. Taken together, these results demonstrate that GM-CSF can significantly enhance the immunogenicity of a defined self-antigen and that this effect is mediated exclusively by activating the T-cell arm of the immune response.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Vaccination with cytokine-producing tumor cells generates potent immune responses against tumors outside the central nervous system (CNS). The CNS, however, is a barrier to allograft and xenograft rejection, and established tumors within the CNS have failed to respond to other forms of systemic immunotherapy. To determine what barriers the "immunologically privileged" CNS would pose to cytokine-assisted tumor vaccines and what cytokines would be most efficacious against tumors within the CNS, we irradiated B16 murine melanoma cells producing murine interleukin 2 (IL-2), IL-3, IL-4, IL-6, gamma-interferon, or granulocyte-macrophage colony stimulating factor (GM-CSF) and used these cells as subcutaneous vaccines against tumors within the brain. Under conditions where untransfected B16 cells had no effect, cells producing IL-3, IL-6, or GM-CSF increased the survival of mice challenged with viable B16 cells in the brain. Vaccination with B16 cells producing IL-4 or gamma-interferon had no effect, and vaccination with B16 cells producing IL-2 decreased survival time. GM-CSF-producing vaccines were also able to increase survival in mice with pre-established tumors. The response elicited by GM-CSF-producing vaccines was found to be specific to tumor type and to be abrogated by depletion of CD8+ cells. Unlike the immunity generated against subcutaneous tumors by GM-CSF, however, the effector responses generated against tumors in the CNS were not dependent on CD4+ cells. These data suggest that cytokine-producing tumor cells are very potent stimulators of immunity against tumors within the CNS, but effector responses in the CNS may be different from those obtained against subcutaneous tumors.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The lineage of dendritic cells (DC), and in particular their relationship to monocytes and macrophages, remains obscure. Furthermore, the requirement for the macrophage growth factor CSF-1 during DC homeostasis is unclear. Using a transgenic mouse in which the promoter for the CSF-1R (c-fms) directs the expression of enhanced GFP in cells of the myeloid lineage, we determined that although the c-fms promoter is inactive in DC precursors, it is up-regulated in all DC subsets during differentiation. Furthermore, plasmacytoid DC and all CD11c(high) DC subsets are reduced by 50-70% in CSF-1-deficient osteopetrotic mice, confirming that CSF-1 signaling is required for the optimal differentiation of DC in vivo. These data provide additional evidence that the majority of tissue DC is of myeloid origin during steady state and supports a close relationship between DC and macrophage biology in vivo.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The initiation of graft-vs-host disease (GVHD) after stem cell transplantation is dependent on direct Ag presentation by host APCs, whereas the effect of donor APC populations is unclear. We studied the role of indirect Ag presentation in allogenic T cell responses by adding populations of cytokine-expanded donor APC to hemopoietic grafts that would otherwise induce lethal GVHD. Progenipoietin-1 (a synthetic G-CSF/Flt-3 ligand molecule) and G-CSF expanded myeloid dendritic cells (DC), plasmacytoid DC, and a novel granulocyte-monocyte precursor population (GM) that differentiate into class II+,CD80/CD86(+),CD40(-) APC during GVHD. Whereas addition of plasmacytoid and myeloid donor DC augmented GVHD, GM cells promoted transplant tolerance by MHC class II-restricted generation of IL-10-secreting, Ag-specific regulatory T cells. Importantly, although GM cells abrogated GVHD, graft-vs-leukemia effects were preserved. Thus, a population of cytokine-expanded GM precursors function as regulatory APCs, suggesting that G-CSF derivatives may have application in disorders characterized by a loss of self-tolerance.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Mobilization is now used worldwide to collect large numbers of hematopoietic stem and progenitor cells (HSPCs) for transplantation. Although the first mobilizing agents were discovered largely by accident, discovery of more efficient mobilizing agents will require a better understanding of the molecular mechanisms responsible. During the past 5 years, a number of mechanisms have been identified, shedding new light on the dynamics of the hematopoietic system in vivo and on the intricate relationship between hematopoiesis, innate immunity, and bone. After briefly reviewing the mechanisms by which circulating HSPCs home into the bone marrow and what keeps them there, the current knowledge of mechanisms responsible for HSPC mobilization in response to hematopoietic growth factors such as granulocyte colony-stimulating factor, chemotherapy, chemokines, and polyanions will be discussed together with current strategies developed to further increase HSPC mobilization. (c) 2006 International Society for Experimental Hematology.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+ T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The local site symmetry of Ce(3+) ions in the diluted magnetic semiconductors Pb(1-x)Ce(x)A (A=S, Se, and Te) has been investigated by electron-paramagnetic resonance (EPR). The experiments were carried out on single crystals with cerium concentration x ranging from 0.001 to 0.035. The isotropic line due to Ce(3+) ions located at the substitutional Pb cation site with octahedral symmetry was observed for all the studied samples. We determined the effective Lande factors to be g=1.333, 1.364, and 1.402 for A=S, Se, and Te, respectively. The small difference with the predicted Lande factor g of 10/7 for the Gamma(7) (J=5/2) ground state was attributed to crystal-field admixture. In addition, EPR lines from Ce(3+) ions located at sites with small distortion from the original octahedral symmetry were also observed. Two distinct sites with axial distortion along the < 001 > crystallographic direction were identified and a third signal in the spectrum was attributed to sites with the cubic symmetry distorted along the < 110 > direction. The distortion at these distinct Ce sites is attributed to Pb lattice vacancies near the cerium ions that compensate for its donor activity.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Vulvovaginal candidiasis, a high prevailing infection worldwide, is mainly caused by Candida albicans. Probiotic Lactobacillus reuteri RC-14 and Lactobacillus rhamnosus GR-1 have been previously shown to be useful as adjuvants in the treatment of women with VVC. In order to demonstrate and better understand the anti-Candida activity of the probiotic microorganisms in an in vitro model simulating vaginal candidiasis, a human vaginal epithelial cell line (VK2/E6E7) was infected with C. albicans 3153a and then challenged with probiotic L. rhamnosus GR-1 and/or L. reuteri RC-14 or their respective CFS (alone or in combination). At each time point (0, 6, 12 and 24 hr), numbers of yeast, lactobacilli and viable VK2/E6E7 cells were determined and, at 0, 6 and 12 hr, the supernatants were measured for cytokine levels. We found that C. albicans induced a significant increase in IL-1 alpha and IL-8 production by VK2/E6E7 cells. After lactobacilli challenge, epithelial cells did not alter IL-6, IL-1 alpha, RANTES and VEGF levels. However, CFS from the probiotic microorganisms up-regulated IL-8 and IP-10 levels secreted by VK2/E6E7 cells infected with C. albicans. At 24 hr of co-incubation, L. reuteri RC-14 alone and in combination with L. rhamnosus GR-1 decreased the yeast population recoverable from the cells. In conclusion, L. reuteri RC-14 alone and together with L. rhamnosus GR-1 have the potential to inhibit the yeast growth and their CFS may up-regulate IL-8 and IP-10 secretion by VK2/E6E7 cells, which could possibly have played an important role in helping to clear VVC in vivo.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Dendritic cells (DC) can be generated by culture of adherent peripheral blood (PB) cells in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4). There is controversy as to whether these DC arise from proliferating precursors or simply from differentiation of monocytes. DC were generated from myeloid-enriched PB non-T cells or sorted monocytes. DC generated from either population functioned as potent antigen-presenting cells. Uptake of [H-3]-thymidine was observed in DC cultured from myeloid-enriched non-T cells. Addition of lipopolysaccharide or tumor necrosis factor-alpha led to maturation of the DC, but did not inhibit proliferation. Ki67(+) cells were observed in cytospins of these DC, and by double staining were CD3(-)CD19(-)CD11c(-)CD40(-) and myeloperoxidase(+), suggesting that they were myeloid progenitor cells. Analysis of the starting population by flow cytometry demonstrated small numbers of CD34(+)CD33(-)CD14(-) progenitor cells, and numerous granulocyte-macrophage colony-forming units were generated in standard assays. Thus, production of DC in vitro from adherent PB cells also enriches for progenitor cells that are capable of proliferation after exposure to GM-CSF. Of clinical importance, the yield of DC derived in the presence of GM-CSF and IL-4 cannot be expanded beyond the number of starting monocytes. (C) 1998 by The American Society of Hematology.