953 resultados para EXTRACTION METHOD
Resumo:
This paper aims to verify the Burnout´s possibilities of incidence, finding the creating dimensions and comparing with the socio-demographics characteristics of the researched professionals. This quantitative-descriptive search has a population of 197 workers of 23 nourishing companies in Rio Grande do Norte. This population is predominantly male, younger than 28 years old, single, relatively instructed (57,07% with complete high school) and having just started their current job since 79% of the interviewees are in the company less than six years. The AUDITORIA DO SISTEMA HUMANO (ASH) model, utilized for investigation and developed for the Spaniards Quijano and Navarro in 1999, has several dimensions about human resources management and the organizational effectiveness, but only makes part of the research in 19 questions Burnout referring. It was used factorial analyses with extraction method, varimax rotation and Kaiser normalization with the intuition to define the creating dimensions of the syndrome, they were evaluated with Cronbach Alpha coefficient after extraction. The dimensions found through the factorial analyses were: emotional exhaustion, physical exhaustion and vitality. The accumulated explanation value reached 65,30% of total variation. The data socio-demographics don t justify the syndrome appearance, because the T test and ANOVA showed irrelevant values. It has been also observed that the founded dimensions were different of the Maslach sociopsychological perspective (emotional exhaustion, depersonalization and low professional realization) allowing comparison with others researches and the possibility to develop new ones with workers from different assistance areas. These new researches are important, since the syndrome refers to chronic labor stress consequences and any professional is favorable to Burnout, harmful to the company as to the collaborators
Resumo:
With the need of the companies in becoming more competitive within the market, it arises an incessant search for selective human potential, with a high level of capacity and low rotativity, which motivation results in production raise, quality optimization and waste reduction. This scenario requires a strategy development which advantages the Human Resources Quality Management. This way, the model of the Human System Audit (HSA), developed by the Spanish researchers Ouijano and Navarro, presents itself as an important tool to diagnosis and evaluation, contemplating the environment where the organization is inserted, its strategies, its organizational design, its processes and its organizational effectiveness. In this sense, the present study has identified the existent relation between the professional satisfaction and the Organizational Culture, based in the model HSA. The research has been a quantitative-descriptive one and has had as population the technical-administrative workers from the Federal Center of Technical Education of Rio Grande do Norte (CEFET RN). The data collection has occurred during May, 2008, by means of the application of a questionnaire in the HSA model. The sample was composed by 167 subjects, distributed among the Five units of the institution. It was used the factorial analysis, with the extraction method of main components and orthogonal rotation varimax, in order to extract the dimensions of the satisfaction and of the organizational culture and the calculation of Cronbach s Alpha coefficient, to evaluate the reliability of these dimensions. The factorial analysis of the satisfaction indicators has identified four factors,, all of them showing significance: gratefulness and relationship , self-realization , stability and security and physical conditions and social benefits . The result of the factorial analysis with the indicators of the organizational culture has extracted four factors and among them, three of them have obtained significance: Personal Satisfaction Style , Competitive-Denial-Power Style and the Conventional-Dependent Style . After identifying the dimensions of the satisfaction and culture found at CEFET-RN, it has been notice the existence or not of relation among them, through the application of Pearson s coefficient. It has been verified that all of the dimensions of the Professional satisfaction are correlated with some dimension of the organizational culture, having in outstand position, with higher intensity, the relation between the culture style of Personal Satisfaction and the satisfaction factor referring to the self-realization
Resumo:
Currently the organizations are passing for continuous cycles of changes due to necessity of survival in the work market. The administration of the future points a way to the organizations of today and tomorrow, the search of the competitiveness from loyalty and motivation of its staff. Of this form, the model of the Auditoria do Sistema Humano (ASH), developed for Spanish researchers and that now it is being applied in Brazil, contemplates a series of dimensions about Human Resources management quality in the companies and the organizational effectiveness, such as the environment where the company is inserted, the strategies, the organizational drawing, the psychological and psychosocial processes, e the reached results. In this direction, the present research analyzed the factors of job satisfaction and organizational commitment, making, also, a relation of causality between the same ones. The quantitative-descriptive research had as population the employees of twenty three nourishing industries of the State of Rio Grande do Norte (Brazil), registered in the Federacy of the Industries of the state. The collection of the data occurred for the months of October of 2005 and March of 2006, by means of the application of questionnaire of model ASH. The sample was composed for 197 employees, however it was observed presence of five outliers, that they had been excluded from the analysis of the data. To extract the dimensions of the satisfaction and the commitment and identification the factorial analysis was used, with extraction method of principal components, rotation Varimax and normalization Kaiser. The gotten dimensions had been evaluated with the calculation of the coefficient Alpha of Cronbach. The factorial analysis of the pointers of the organizational commitment and identification had extracted ten factors. Of these, four had gotten significance of the analyses inside: affective commitment, values commitment, continuance commitment and necessity commitment. The result of the analysis of the pointers of job satisfaction indicated four factors: extrinsic, motivations, relation with the friends and auto-accomplishment. To deal with the data the relation between job satisfaction and organizational commitment it was used technique of multiple regression. The correlation between commitment and satisfaction was satisfactory, detaching the affective commitment with bigger index of correlation, followed of the affective one
Resumo:
Dengue, amongst the virus illnesses one can get by vectorial transmission, is the one that causes more impact in the morbidity and mortality of world s population. The resistance to the insecticides has caused difficulties to control of vector insect (Aedes aegypti) and has stimulated a search for vegetables with larvicidal activity. The biodiversity of Caatinga is barely known and it is potential of use even less. Some plants of this biome are commercialized in free fairs northeast of Brazil, because of its phytotherapics properties. The vegetables in this study had been selected by means of a questionnaire applied between grass salesmen and natives of the Serido region from Rio Grande do Norte state; culicids eggs had been acquired with traps and placed in container with water for the larva birth. Thirty larvae had been used in each group (a group control and five experimental groups), with four repetitions four times. The vegetables had been submitted to the processes of decoction, infusion and maceration in the standard concentration of 100g of the vegetable of study in 1l of H2O and analyzed after ½, 1, 2, 4, 8, 12, 24 and 48 hours for verification of the average lethal dose (LD50) from the groups with thirty larva. The LD50 was analyzed in different concentrations (50g/l, 100g/l, 150g/l, 200g/l e 300g/l) of Aspidosperma pyrifolium Mart. 48 extracts of rind, leaf and stem of the seven vegetal species: Aspidosperma pyrifolium Mart., Mimosa verrucosa Benth, Mimosa hostilis (Mart.) Benth., Myracrodruon urundeuva Allemão, Ximenia americana L, Bumelia sartorum Mart Zizyphus joazeiro Mart, had been analyzed. The extracts proceeding from the three methods were submitted to the freezedrying, to evaluate and to quantify substances extracted in each process. The results had shown that Aspidosperma pyrifolium Mart. and Myracrodruon urundeuva Allemão are the species that are more distinguished as larvicidal after 24 hours of experiment, in all used processes of extraction in the assays. The Zizyphus joazeiro Mart species has not shown larvicidal activity in none of the assays. In relation to the extraction method, the decoction was the most efficient method in the mortality tax of the A. aegypti larvae
Resumo:
Kalanchoe brasiliensis Cambess (Crassulaceae), commonly known as saião , coirama branca , folha grossa , is originally from Brazil and commonly found in São Paulo to Bahia, mainly in the coastal zone. Regarding of biological activities, most preclinical studies were found in the literature, mainly about the anti-inflammatory activity of extracts obtained from leaves and / or aerial parts of K. brasiliensis. As regards the chemical constitution, it has been reported mainly the presence of flavonoids in the leaves of the species, but until this moment did not knows which are the active compounds. Although it is a species widely used in traditional medicine in Brazil, there is no monograph about the quality parameters of the plant drug. In this context, this study aims to characterize and quantify the chemical markers of hydroethanolic extract (HE) from the leaves of K. brasiliensis, which can be used in quality control of plant drug and derivatives obtained from this species. The methodology was divided into two parts: i. Phytochemical study: to fractionate, isolate and characterizate of the chemical (s) marker (s) of the HE from the leaves of K. brasiliensis; ii. To Developed validate of analytical method by High Performance Liquid Chromatography (HPLC)-diode array detector (DAD) to quantify the chemical (s) marker (s) of the EH. i. The EH 50% was prepared by turbo extraction method. It was then submitted to liquid-liquid partition, obtaining dichloromethane, n-butanol and ethyl acetate (AcOEt) fractions. The AcOEt fraction was selected to continue the fractionation process, because it has a chemical profile rich in flavonoids. The acOEt fraction was submitted to column chromatography using different systems for obtaining the compound Kb1. To identify this compound, it was submitted to UV analysis ii. For quantitative analysis, the EH was analyzed by HPLC, using different methods. After selecting the most appropriate method, which showed satisfactory resolution and symmetrical peaks, it was validated according to parameters in the RE 899/2003. As result, it was obtained from the AcOEt fraction the compound Kb1 (2.7 mg). Until this moment, the basic nucleus was characterized by UV analysis using shift reagents. The partial chemical structure of the compound Kb1 was identified as a flavonol, containing hydroxyls in 3 , 4 position (ring A), 5 and 7 free (ring B) and a replacement of the C3 hydroxyl by a sugar. As the analysis were performed in the HPLC coupled to a DAD, we observed that the UV spectrum of the major peaks of EH from K. brasiliensis shown similar UV spectrum. According to the literature, it has been reported the presence of patuletin glycosydes derivatives in the leaves of this species. Therefore, it is suggested that the compound Kb1 is glycosylated patuletin derivative. Probably the sugar (s) unit(s) are linked in the C3 in the C ring. . Regarding the development of HPLC analytical method, the system used consists of phase A: water: formic acid (99,7:0,3, v / v) and phase B: methanol: formic acid (99,7:0,3, v / v), elution gradient of 40% B - 58% B in 50 minutes, ccolumn (Hichrom ®) C18 (250x4, 0 mm, 5 μm), flow rate 0.8 mL / min, UV detection at 370 nm, temperature 25 ° C. In the analysis performed with the co-injection of thecompound Kb1 + HE of K. brasiliensis was observed that it is one of the major compounds with a retention time of 12.47 minutes and had a content of 15.3% in EH of leaves from K. brasiliensis. The method proved to be linear, precise, accurate and reproducible. According to these results, it was observed that compound Kb1 can be used as a chemical marker of EH from leaves of K. brasiliensis, to assist in quality control of drug plant and its derivatives
Resumo:
Desenvolveu-se um método rápido para extração de DNA de bactérias, que ao contrário de outros métodos, não requer o uso de enzimas, como lisozima e proteinase K, previamente, utilizado-se o carbonato de silício (carborundum) como agente físico para efetuar a quebrar da parede celular da bactéria. Com este método conseguiu-se extrair DNA bacteriano num menor tempo, além de mais rápido, ele mostrou-se mais simples e econômico, quando comparado aos métodos convencionais. O DNA obtido pode ser utilizado para diversas finalidades relacionadas ao DNA de bactérias, obtendo-se uma quantidade razoável de DNA, que varia de 725 µg/mL a 1170 µg/mL por cada 0,1 g de célula bacteriana, com ótima qualidade.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The extraction with pressurized fluids has become an attractive process for the extraction of essential oils, mainly due the specific characteristics of the fluids near the critical region. This work presents results of the extraction process of the essential oil of Cymbopogon winterianus J. with CO2 under high pressures. The effect of the following variables was evaluated: solvent flow rate (from 0.37 to 1.5 g CO2/min), pressure (66.7 and 75 bar) and temperature (8, 10, 15, 20 and 25 ºC) on the extraction kinetics and the total yield of the process, as well as in the solubility and composition of the C. winterianus essential oil. The experimental apparatus consisted of an extractor of fixed bed and the dynamic method was adopted for the calculation of the oil solubility. Extractions were also accomplished by conventional techniques (steam and organic solvent extraction). The determination and identification of extract composition were done by gas chromatography coupled with a mass spectrometer (GC-MS). The extract composition varied in function of the studied operational conditions and also related to the used extraction method. The main components obtained in the CO2 extraction were elemol, geraniol, citronellol and citronellal. For the steam extraction were the citronellal, citronellol and geraniol and for the organic solvent extraction were the azulene and the hexadecane. The most yield values (2.76%) and oil solubility (2.49x10-2 g oil/ g CO2) were obtained through the CO2 extraction in the operational conditions of T = 10°C, P = 66.7 bar and solvent flow rate 0.85 g CO2/min
Resumo:
The work aimed to study the development of Tabebuia chrysotricha Standl. seedlings injunction of different substrate and different fertilization solutions. To compose the substrate it was used fibrous and granulated coconut fiber obtaining the following treatments: S1- 100% fibrous, S2- 60% fibrous and 40% granulated, S3- 40% fibrous and 60% granulated and S4- 100% granulated. The basis fertilization was the same for all treatments and the solutions of fertilization varied in order to obtain solutions with the following electric conductivities: EC1- 1.06 dS m(-1), EC2- 2.12 dS m(-1), EC3- 3.2 dS m(-1) and EC4- 4.25 dS m(-1). The propagative material was sowed directly in plastic containers (120mL) with the respective substrates. The fertilization was received through sub irrigation once a week, until the seedlings reached 20cm of height approximately. The chemical analyses of the substrate (EC and pH), through aqueous extraction method 1:1.5 (1 substrate: 1.5 deionized water), the analyses of aerial part height, stein diameter and pairs true leaves number, as well as the weight of total dry, matter, were accomplished each 15 days. In almost every analysis, the substrate with granulated coconut fiber, as well as the smallest EC (1.06 e 2.12 dS m(-1)) of fertilization solutions,formed seedlings with higher averages, indicating faster growth. In the conditions of this experiment, the production of T. chrysotricha seedlings was better in granulated coconut fiber substrate and fertilizer solutions with EC of 1.06 dS m(-1), appreciating the estimated characteristics.
Resumo:
Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). de acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Three methods of extraction of lipopolysaccharide (LPS) were compared-the conventional hot phenol-water method with 40% phenol, a modified form of this method using 10% phenol, and the hot saline method. Good recovery of LPS was achieved by each of the three methods, with the LPS found in the aqueous phase with the two phenol-based procedures. The application of SDS-PAGE to the LPS extracts, followed by silver staining, showed similar banding with all three methods of extraction. When the hot saline extraction LPS fraction from eight strains of Bradyrhizobium spp. and eight strains of Bradyrhizobium japonicum was compared with SDS-PAGE, characteristic profiles were achieved. Serological analysis of eight strains of Bradyrhizobium spp., using antisera prepared against whole cells in agglutination reactions, showed extensive sharing of antigens. When antisera was prepared using outer membrane LPS, extracted by the hot saline method, the amount of cross-reaction was reduced greatly. The results indicated that LPS provide an efficient means of obtaining monospecific antisera to be used for serological identification of strains of Bradyrhizobium spp. and that the hot saline extraction method is recommended for a fast, simple and efficient way to obtain LPS and characterize this bacterium.
Resumo:
In this study, an in situ derivatization and extraction method for the determination of pentachlorophenol (PCP) has been applied successfully in the analysis of water samples. The PCP derivative analysis was performed by gas-liquid chromatography with electron capture detection. The limit of detection of the method is 1 μg/L and recoveries averaged 78-108% for PCP acetate at levels of 2, 10 and 20 μg/L.
Resumo:
Plants have been used in the cure of diseases from the origins of the humanity. At present, in Brazil, the use is common because of the difficulty of access of part of the population to medical assistance. It is commonly believed that the medicinal plants of traditional use were already tested and ratified by the long-lasting use by the human species, being considered effective medicines, presenting no collateral effects, not needful, therefore, of evaluation. The miraculous self-medication with medicinal plants goes to the point of substituting therapies in serious diseases such as those of hypoglycemic or anti-diabetic effect. For the test of medicinal plants, it is necessary to consider the material quality to be tested, the plant component used, extraction method, dosage, and the experimental species used. Several plants have already had hypoglycemic effects proven experimentally. The objective of this paper was to accomplish a revision of Brazilian medicinal plants, used popularly, as hypoglycemics that had effects proven in animals and in humans.