Mycobacterium chelonae valve endocarditis resulting from contaminated biological prostheses

Objectives: A rapid-growing mycobacteria biological prosthetic valve (BPV) endocarditis related to prosthetic manufacturing process is described in Brazil. Methods: From 1999 to 2008, thirty-nine patients underwent BPV replacement due to culture-negative suspected endocarditis. All these cases had histological sections stained by Ziehl-Neelsen method. Clinical and microbiological data were reviewed in all acid-fast bacilli (AFB) positive cases. The 16S-23S internal transcribed sequence (ITS) was amplified using DNA extracted from paraffin-embedded samples, digested with restrictions enzymes and/or sequenced. Results: Eighteen AFB positive BPV (18/39)(46%) were implanted in 13 patients and were from the same manufacturer. Four of them were implanted in other hospitals. Thirteen BPV were histologically proven endocarditis and five showed a colonization pattern. The examination of six non-implanted ""sterile"" BPV from this manufacturer resulted in 5 AFB positive. Mycobacterium chelonae was the AFB identified by ITS restriction analysis and sequencing. Conclusions: Rapid-growing mycobacteria infections must be suspected and Ziehl-Neelsen stain always performed on histology of either early or late BPV endocarditis, particularly when blood cultures are negative. (C) 2010 The British Infection Society. Published by Elsevier Ltd. All rights reserved.

Variation of Patterns of Malocclusion by Site of Pharyngeal Obstruction in Children

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Salvage of long-term central venous catheters during an outbreak of Pseudomonas putida and Stenotrophomonas maltophilia infections associated with contaminated heparin catheter-lock solution

objective. To describe the management of patients with long-term central venous catheters (CVCs) during an outbreak of infection due to Pseudomonas putida and Stenotrophomonas maltophilia associated with contaminated heparin catheter-lock solution. design. Descriptive study. setting. Private, 250-bed tertiary-care hospital. methods. In March 2003, we identified 2 febrile cancer patients with P. putida bacteremia. Over 2 days, 7 cases of bacteremia were identified; lots of syringes prefilled with heparin catheter-lock solution, supplied by a compounding pharmacy, were recalled and samples were cultured. More cases of bacteremia appeared during the following days, and any patient who had had a catheter lock infused with the suspect solution was asked to provide blood samples for culture, even if the patient was asymptomatic. Isolates that were recovered from culture were typed by pulsed-field gel electrophoresis. Antimicrobial salvage treatment of long-term CVCs was attempted. results. A total of 154 patients had had their catheter lock infused with solution from the lots that were suspected of being contaminated. Only 48 of these patients had CVCs. By day 7 of the outbreak, 18 of these patients had become symptomatic. Twenty-six of the remaining 30 asymptomatic patients then also provided blood samples for culture, 10 of whom developed fever shortly after samples were collected. Thirty-two patients were identified who had P. putida bacteremia; 9 also had infection due to S. maltophilia. Samples from 1 of the 3 lots of prefilled syringes in use at the time of the outbreak also grew P. putida on culture. Molecular typing identified 3 different clones of P. putida from patients and heparin catheter-lock solution, and 1 clone of S. maltophilia. A total of 27 patients received antimicrobial therapy regimens, some of which included decontamination of the catheter lock with anti- infective lock solution. Of 27 patients, 19 (70%) retained their long-term CVC during the 6-month follow-up period. conclusions. To our knowledge, this is one of the largest prospective experiences in the management of bloodstream infection associated with long-term CVCs. The infections were caused by gram-negative bacilli and were managed without catheter removal, with a high response rate. We emphasize the risks of using intravenous formulations of medications supplied by compounding pharmacies that produce large quantities of drugs.

Influence of Suture on Peripheral Nerve Regeneration and Collagen Production at the Site of Neurorrhaphy: An Experimental Study

BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.

The outer wall of small airways is a major site of remodeling in fatal asthma

Background: Structural and inflammatory changes in asthma involve both the large and small airways, with involvement of the distal lung being related to disease severity. We have previously shown that changes in the extracellular matrix (ECM) composition of the distal lung are associated with loss of alveolar attachments in patients with fatal asthma. However, major ECM elements, such as collagen I and fibronectin and their regulators, have not been addressed at the distal level. Objective: We sought to evaluate ECM remodeling in the distal lungs of asthmatic patients. Methods: Using immunohistochemistry and image analysis, we determined the content of collagen I and III, fibronectin, and matrix metalloproteinases; (MMPs) 1, 2, and 9 and tissue inhibitors of metalloproteinase (MMPs) 1 and 2 in the large and small airways and lung parenchyma of 24 patients with fatal asthma and compared the results with those of 11 nonasthmatic control subjects. Protein content was defined as the area of positive staining divided by basement membrane or septum length. Results: We observed increased collagen I and decreased collagen III content in the small airways of asthmatic patients compared with that seen in control subjects. Greater fibronectin and MMP-1, MMP-2, and MMP-9 content was observed at the outer area of the small airways in asthmatic patients. NIMP content was also increased in the peribronchiolar parenchyma in asthmatic patients. In contrast, TIMP expression was only increased in the large airways of asthmatic patients compared with that seen in control subjects. Conclusions: The outer area of the small airways is a major site of ECM remodeling in fatal asthma, potentially contributing to functional changes and the loss of airway-parenchyma interdependence observed in patients with fatal asthma. (J Allergy Clin Immunol 2009;123:1090-7.)

Biomonitoring genotoxic risks under the urban weather conditions and polluted atmosphere in Santo Andre, SP, Brazil, through Trad-MCN bioassay

The present study was made to check if the Trad-MCN bioassay, developed with inflorescences of Tradescantia pallida cv. Purpurea, might discriminate genotoxic risks in areas of the city of Santo Andre (SE Brazil) contaminated by different air pollutants, and periods of the year when risks are higher, and to determine if the variations in the frequency of micronuclei (MCN) can be explained by environmental factors that characterize the stressful situation in each site. Potted plants were exposed in sites highly contaminated by ozone (Capuava and School) and in sites reached by high vehicular emissions (downtown and Celso Daniel Park). Pedroso Park, far from the polluted areas, was taken as reference. From September 2003 to September 2004, 20 young inflorescences were collected twice a week from each place and the frequencies of MCN were estimated. The environmental conditions observed in the polluted sites were stressful enough to promote an increase of MCN, mainly in sites reached by high vehicular emissions. But MCN rates in Capuava and at Celso Daniel Park could not be predicted only by pollutants which characterized the air contamination in these sites. More severe weather conditions, mainly low temperature, relative humidity and rainfall, caused an increase of MCN. Improvement of the biomonitoring system is recommended to minimize this negative influence of weather factors. (C) 2008 Elsevier Inc. All rights reserved.