773 resultados para telomeric repeat amplification protocol
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.
Resumo:
Dysphagia is a symptom associated with an array of anatomical and functional changes which must be assessed by a multidisciplinary team to guarantee optimal evaluation and treatment, preventing potential complications. Aim: The aim of the present study is to present the combined protocol of clinical and swallowing videoendoscopy carried by ENT doctors and speech therapists in the Dysphagia Group of the ENT Department - University Hospital. Materials and Methods: Retrospective study concerning the use of a protocol made up of patient interview and clinical examination, followed by an objective evaluation with swallowing videoendoscopy. The exam was performed in 1,332 patients from May 2001 to December 2008. There were 726 (54.50%) males and 606 (45.50%) females, between 22 days and 99 years old. Results: We found: 427 (32.08%) cases of normal swallowing, 273 (20.48%) mild dysphagia, 224 (16.81%) moderate dysphagia, 373 (27.99%) severe dysphagia and 35 (2.64%) inconclusive exams. Conclusion: The combined protocol (Otolaryngology and Speech Therapy), is a good way to approach the dysphagic patient, helping to achieve early and safe deglutition diagnosis as far as disorder severity and treatment are concerned.
Resumo:
Sepsis remains a challenge for intensive care physicians, as it keeps up with high mortality rate in spite of the high costs associated with its treatment. Several studies indicate that the infusion of Drotrecogin-alpha activated (DrotAA) reduce mortality in patients at high risk of death when administered early and secured the appropriate initial treatment of sepsis as recommended by Surviving Sepsis Campaign. Europe and United States of America differ regarding the criteria of high risk of death in sepsis, two or more organ dysfunctions and Acute Physiology and Chronic Health Evaluation 25 or more, respectively. In addition to varied definitions of high risk of death for inclusion of patients in sepsis studies, the possibility of bleeding related to drug use and intrinsic limitations related to study design led the Company to develop a new randomized, multinational, placebo-controlled, double-blind study to assess the effectiveness of drug in patients with septic shock in adults.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
To evaluate the remodeling of collagen fibers in the articular cartilage of rat ankles, with and without immobilization, after application of muscle stretching protocol. Twenty three Wistar rats were divided into four groups: immobilized (I), n = 6; immobilized and stretched (IS), n = 6; stretched (S), n = 6 and control (C), n = 5. The animals in groups I and IS were submitted to immobilization. After the period of immobilization, the animals in groups IS and S were submitted to a muscle stretching protocol. At the end of the experiment, the animals were euthanized and the joints removed, processed and stained with Picrosirius red. The analysis was carried out using a polarized light microscope. The density of collagen fibers were quantified according to the intensity of birefringence displayed. By way of statistical analyses, the right and left hind limbs of the different groups were compared based on the total density of collagen fibers, the density of thick collagen fibers and the density of thin collagen fibers. Immobilization promoted a reduction in density of the thin fibers and of total collagen. The muscle stretching protocol after immobilization promoted a reduction in density of the total collagen and of the thick fibers, but the density of the thin fibers showed the same values as control. The collagen fibers were remodeled by the different stimuli. Immobilization was harmful to the collagen fibers and the muscle stretching protocol only recovered the thin collagen fibers.
Resumo:
The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.
Resumo:
Background Recently, there has been an increase in the incidence of cutaneous leishmaniasis (CL), which represents an important health problem. This increase may be related to the epidemiologic expansion of the infective agent and the increase in tourism in tropical areas. The difficulty in clinical diagnosis, mainly in areas in which CL is not the first consideration of local physicians, has intensified efforts to describe diagnostic tests, which should be specific, sensitive, and practical. Amongst the new tests described are those including nucleic acid amplification (polymerase chain reaction, PCR) and immunohistochemistry (IHC). Methods In this study, we evaluated the sensitivity of a PCR based on small subunit (SSU) ribosomal DNA, in comparison with IHC using Leishmania spp. antibodies, in biopsies embedded in paraffin. Result The results indicated a total sensitivity of 96% (90.9% with PCR and 68.8% with IHC), showing the possibility of using paraffin-embedded biopsies to diagnose CL. Conclusion We propose the use of the two tests together as a routine protocol for diagnosis. This would require the provision of local medical services to perform molecular biology techniques and adequate Leishmania antibodies.
Resumo:
A rapid DNA extraction was used for T. cruzi detection in triatomines dry fecal spots collected on filter paper and analyzed by PCR. Fifty T infestans were fed on experimentally infected Balb/C mice with high T. cruzi parasitemia and divided into five groups of len triatomines, and 100 triatomines were infected with lower parasitemia and divided into five groups of 20 triatomines, One dry fecal spot was analyzed per group on days 1, 2, 3, 4 and 5 post feeding. Amplification targeted T. cruzi TCZ sequence and resulted positive from day 4 after bugs feeding in the two models (high and lower parasitemia). The rapid DNA isolation and PCR proposed are suitable for detection of T. cruzi DNA in in filter paper and should be considered in field research.
Resumo:
Purpose: The objective of this study is to evaluate blood glucose (BG) control efficacy and safety of 3 insulin protocols in medical intensive care unit (MICU) patients. Methods: This was a multicenter randomized controlled trial involving 167 MICU patients with at least one BG measurement +/- 150 mg/dL and one or more of the following: mechanical ventilation, systemic inflammatory response syndrome, trauma, or burns. The interventions were computer-assisted insulin protocol (CAIP), with insulin infusion maintaining BG between 100 and 130 mg/dL; Leuven protocol, with insulin maintaining BG between 80 and 110 mg/dL; or conventional treatment-subcutaneous insulin if glucose > 150 mg/dL. The main efficacy outcome was the mean of patients` median BG, and the safety outcome was the incidence of hypoglycemia (<= 40 mg/dL). Results: The mean of patients` median BG was 125.0, 127.1, and 158.5 mg/dL for CAIP, Leuven, and conventional treatment, respectively (P = .34, CAIP vs Leuven; P < .001, CAIP vs conventional). In CAIP, 12 patients (21.4%) had at least one episode of hypoglycemia vs 24 (41.4%) in Leuven and 2 (3.8%) in conventional treatment (P = .02, CAIP vs Leuven; P = .006, CAIP vs conventional). Conclusions: The CAIP is safer than and as effective as the standard strict protocol for controlling glucose in MICU patients. Hypoglycemia was rare under conventional treatment. However, BG levels were higher than with IV insulin protocols. (C) 2009 Elsevier Inc. All rights reserved.
Resumo:
Paraffin-embedded samples commonly stored at educational and research institutions constitute tissues banks for follow-up or epidemiological studies; however, the paraffin inclusion process involves the use of substances that can cause DNA degradation. In this study, a PCR protocol was applied to identify Leishmania strains in 33 paraffin-embedded skin samples of patients with American cutaneous leishmaniasis. DNA was obtained by the phenol-chloroform protocol following paraffin removal and then used in PCR or nested PCR based on the nucleotide sequence of the small subunit ribosomal RNA (SSU rDNA). The amplicons obtained were cloned and sequenced to determine the single nucleotide polymorphism that distinguishes between different Leishmania species or groups. This assay allowed to distinguish organisms belonging to the subgenus Viannia and identify L. (Leishmania) amazonensis and L. (L.) chagasi of the Leishmania subgenus. Of the 33 samples, PCR and nested PCR identified 91% of samples. After sequencing the PCR product of 26 samples, 16 were identified as L. (L.) amazonensis, the other 10 contain organisms belonging to the L. (Viannia) sub-genus. These results open a huge opportunity to study stored samples and promote relevant contributions to epidemiological studies.
Resumo:
Background: Steroidogenic factor 1 (SF-1) is a key determinant of endocrine development and function of adrenal cortex. SF-1 overexpression and gene amplification were previously demonstrated in a small group of pediatric adrenocortical tumors. Objective: Our objective was to determine the frequency of SF-1 protein expression and gene amplification in a large cohort of pediatric and adult adrenocortical tumors. Patients: SF-1 protein expression was assessed in a cohort of 103 adrenocortical tumors from 36 children and 67 adults, whereas gene amplification was studied in 38 adrenocortical tumors ( 17 from children). Methods: Tissue microarray, multiplex ligation-dependent probe amplification, and quantitative real-time PCR were used. Results: Astrong nuclear SF-1 expression was detected by tissue microarray in 56% (20 of 36) and 19% (13 of 67) of the pediatric and adult adrenocortical tumors, respectively (P = 0.0004). Increased SF-1 copy number was identified in 47% (eight of 17) and 10% (two of 21) of the pediatric and adult adrenocortical tumors, respectively (P = 0.02). All adrenocortical tumors with SF-1 gene amplification showed a strong SF-1 staining, whereas most of the tumors (61%) without SF-1 amplification displayed a weak or negative staining (P = 0.0008). Interestingly, a strong SF-1 staining was identified in five (29%) pediatric adrenocortical tumors without SF-1 amplification. The frequency of SF-1 overexpression and gene amplification was similar in adrenocortical adenomas and carcinomas. Conclusion: We demonstrated a higher frequency of SF-1 overexpression and gene amplification in pediatric than in adult adrenocortical tumors, suggesting an important role of SF-1 in pediatric adrenocortical tumorigenesis. (J Clin Endocrinol Metab 95: 1458-1462, 2010)