X-Ray studies of the physics of matter around super-massive black-holes in nearby Seyfert galaxies

Seyfert galaxies are the closest active galactic nuclei. As such, we can use them to test the physical properties of the entire class of objects. To investigate their general properties, I took advantage of different methods of data analysis. In particular I used three different samples of objects, that, despite frequent overlaps, have been chosen to best tackle different topics: the heterogeneous BeppoS AX sample was thought to be optimized to test the average hard X-ray (E above 10 keV) properties of nearby Seyfert galaxies; the X-CfA was thought the be optimized to compare the properties of low-luminosity sources to the ones of higher luminosity and, thus, it was also used to test the emission mechanism models; finally, the XMM–Newton sample was extracted from the X-CfA sample so as to ensure a truly unbiased and well defined sample of objects to define the average properties of Seyfert galaxies. Taking advantage of the broad-band coverage of the BeppoS AX MECS and PDS instruments (between ~2-100 keV), I infer the average X-ray spectral propertiesof nearby Seyfert galaxies and in particular the photon index (~1.8), the high-energy cut-off (~290 keV), and the relative amount of cold reflection (~1.0). Moreover the unified scheme for active galactic nuclei was positively tested. The distribution of isotropic indicators used here (photon index, relative amount of reflection, high-energy cut-off and narrow FeK energy centroid) are similar in type I and type II objects while the absorbing column and the iron line equivalent width significantly differ between the two classes of sources with type II objects displaying larger absorbing columns. Taking advantage of the XMM–Newton and X–CfA samples I also deduced from measurements that 30 to 50% of type II Seyfert galaxies are Compton thick. Confirming previous results, the narrow FeK line is consistent, in Seyfert 2 galaxies, with being produced in the same matter responsible for the observed obscuration. These results support the basic picture of the unified model. Moreover, the presence of a X-ray Baldwin effect in type I sources has been measured using for the first time the 20-100 keV luminosity (EW proportional to L(20-100)^(−0.22±0.05)). This finding suggests that the torus covering factor may be a function of source luminosity, thereby suggesting a refinement of the baseline version of the unifed model itself. Using the BeppoSAX sample, it has been also recorded a possible correlation between the photon index and the amount of cold reflection in both type I and II sources. At a first glance this confirms the thermal Comptonization as the most likely origin of the high energy emission for the active galactic nuclei. This relation, in fact, naturally emerges supposing that the accretion disk penetrates, depending to the accretion rate, the central corona at different depths (Merloni et al. 2006): the higher accreting systems hosting disks down to the last stable orbit while the lower accreting systems hosting truncated disks. On the contrary, the study of the well defined X–C f A sample of Seyfert galaxies has proved that the intrinsic X-ray luminosity of nearby Seyfert galaxies can span values between 10^(38−43) erg s^−1, i.e. covering a huge range of accretion rates. The less efficient systems have been supposed to host ADAF systems without accretion disk. However, the study of the X–CfA sample has also proved the existence of correlations between optical emission lines and X-ray luminosity in the entire range of L_(X) covered by the sample. These relations are similar to the ones obtained if high-L objects are considered. Thus the emission mechanism must be similar in luminous and weak systems. A possible scenario to reconcile these somehow opposite indications is assuming that the ADAF and the two phase mechanism co-exist with different relative importance moving from low-to-high accretion systems (as suggested by the Gamma vs. R relation). The present data require that no abrupt transition between the two regimes is present. As mentioned above, the possible presence of an accretion disk has been tested using samples of nearby Seyfert galaxies. Here, to deeply investigate the flow patterns close to super-massive black-holes, three case study objects for which enough counts statistics is available have been analysed using deep X-ray observations taken with XMM–Newton. The obtained results have shown that the accretion flow can significantly differ between the objects when it is analyzed with the appropriate detail. For instance the accretion disk is well established down to the last stable orbit in a Kerr system for IRAS 13197-1627 where strong light bending effect have been measured. The accretion disk seems to be formed spiraling in the inner ~10-30 gravitational radii in NGC 3783 where time dependent and recursive modulation have been measured both in the continuum emission and in the broad emission line component. Finally, the accretion disk seems to be only weakly detectable in rk 509, with its weak broad emission line component. Finally, blueshifted resonant absorption lines have been detected in all three objects. This seems to demonstrate that, around super-massive black-holes, there is matter which is not confined in the accretion disk and moves along the line of sight with velocities as large as v~0.01-0.4c (whre c is the speed of light). Wether this matter forms winds or blobs is still matter of debate together with the assessment of the real statistical significance of the measured absorption lines. Nonetheless, if confirmed, these phenomena are of outstanding interest because they offer new potential probes for the dynamics of the innermost regions of accretion flows, to tackle the formation of ejecta/jets and to place constraints on the rate of kinetic energy injected by AGNs into the ISM and IGM. Future high energy missions (such as the planned Simbol-X and IXO) will likely allow an exciting step forward in our understanding of the flow dynamics around black holes and the formation of the highest velocity outflows.

Unconventional correlated systems

This work comprises three different types of unconventional correlated systems.rnChapters 3-5 of this work are about the open shell compounds Rb4O6 and Cs4O6. These mixed valent compounds contain oxygen in two different modifications: the closed-shell peroxide anion is nonmagnetic, whereas the hyperoxide anion contains an unpaired electrons in an antibonding pi*-orbital. Due to this electron magnetic ordering is rendered possible. In contrast to theoretical predictions, which suggested half-metallic ferromagnetism for Rb4O6,rndominating antiferromagnetic interactions were found in the experiment. Besidesrna symmetry reduction due to the mixed valency, strong electronic correlations of this highly molecular system determine its properties; it is a magnetically frustrated insulator. The corresponding Cs4O6 was found to show similar properties.rnChapters 6-9 of this work are about intermetallic Heusler superconductors. rnAll of these superconductors were rationally designed using the van Hove scenario as a working recipe. A saddle point in the energy dispersion curve of a solid leads to a van Hove singularity in the density of states. In the Ni-based and Pd-based Heusler superconductors presented in this work this sort of a valence instability occurs at the high-symmetry L point and coincides or nearly coincides with the Fermi level. The compounds escape the high density of states at the Fermi energy through a transition into the correlated superconducting state.rnChapter 10 of this work is about the tetragonally distorted ferrimagnetic DO22 phase of Mn3Ga. This hard-magnetic modification is technologically useful for spin torque transfer applications. The phase exhibits two different crystallographic sites that are occupied by Mn atoms and can thus be written as Mn2MnGa. The competition between the mainly itinerant moments of the Mn atoms at the Wyckoff position 4d and the localized moments of the Mn atoms at the Wyckoff position 2b leads to magnetic correlations. The antiferromagnetic orientation of these moments determines the compound to exhibit a resulting magnetic moment of approximately 1 µB per formula unit in a partially compensated ferrimagnetic configuration.

Funktionelle Analyse der Meprin-Metalloproteasen alpha und beta hinsichtlich ihrer physiologischen Regulation und biologischen Bedeutung

Im Rahmen dieser Arbeit ist es gelungen, ein besseres Verständnis der beiden Metalloproteasen Meprin α und β in ihrem proteolytischen Netzwerk hinsichtlich ihrer physiologischen Regulation durch endogene Inhibitoren, wie auch der biologischen Funktion von Meprin α für den Prozess der Angiogenese, zu erlangen. rnMit der Analyse des ersten identifizierten endogenen Meprin-Inhibitors Fetuin-A gelang die Bestimmung der Ki-Werte für Meprin α mit 4,2 x 10-5 M und 1,1 x 10-6 M für Meprin β. Des Weiteren konnte für Meprin β eine Schnittstelle im Fetuin-A validiert werden. Mit der Identifizierung von Cystatin C, einem Cystein-Protease-Inhibitor als endogener Inhibitor der Metalloprotease Meprin α, mit einem Ki-Wert von 8,5 x 10-6 M, wurden erstmals Proteasefamilie-übergreifende Inhibitionsmechanismen für Metalloproteasen offenbart.rnDie Analyse von drei potentiellen Meprin-Inhibitoren, identifiziert als Substrate in einem neuen Proteomics-Analyse-Verfahren terminal amine isotopic labeling of substrates (TAILS), ermöglichte die Charakterisierung von Elafin als spezifischen Meprin α-Inhibitor. Für Elafin ist es außerdem gelungen, die durch TAILS ermittelte Schnittstelle für Meprin α mittels Edman Sequenzierung zu validieren. Der secretory leukocyte peptidase inhibitor (SLPI), ein Elafin-Homolog, konnte als weiteres Meprin α-Substrat bestätigt werden. Außerdem gelang es, die Meprin α-Schnittstelle im SLPI zu validieren.rnEin weiteres Ziel dieser Arbeit war, ein besseres Verständnis der biologischen Funktion der Metalloprotease Meprin α zu erlangen. Hier konnte in vivo eine stark pro-angiogene Wirkung von Meprin α gezeigt werden und erstmals die Expression von Meprin α, jedoch nicht von Meprin β, in Endothelzellen nachgewiesen werden. Zugleich konnte mit der Analyse der durch die TAILS-Methode identifizierten pro-angiogenen Substrate vascular endothelial growth factor A (VEGF-A) und connective tissue growth factor (CTGF) der Regulationsmechanismus von Meprin α in der Angiogenese identifiziert werden. So ist Meprin α durch die Spaltung von CTGF in der Lage VEGF-A – gebunden und inhibiert im Komplex mit CTGF – durch proteolytische Spaltung von CTGF wieder freizusetzen. Somit wird die inhibierte VEGF-A-Aktivität wieder vollständig hergestellt. rnMit der Charakterisierung der ersten endogenen Meprin-Inhibitoren ist es gelungen, zu einem besseren Verständnis der endogenen Regulation der Meprine beizutragen und eine Proteasefamilie-übergreifende endogene Regulation aufzuzeigen. Mit der Entdeckung von Meprin α als pro-angiogene Protease und der Entschlüsselung des angiogenen Regulationsmechanismus konnte eine essentielle biologische Bedeutung dieser Protease beschrieben werden.rn

Systematic functionalization of molecules for molecular self-assembly

This thesis describes the investigation of systematically varied organic molecules for use in molecular self-assembly processes. All experiments were performed using high-resolution non-contact atomic force microscopy under UHV conditions and at room temperature. Using this technique, three different approaches for influencing intermolecular and molecule-surface interaction on the insulating calcite(10.4) surface were investigated by imaging the structure formation at the molecular scale. I first demonstrated the functionalization of shape-persistent oligo(p-benzamide)s that was engineered by introducing different functional groups and investigating their effect on the structural formation on the sample surface. The molecular core was designed to provide significant electrostatic anchoring towards the surface, while at the same time maintaining the flexibility to fine-tune the resulting structure by adjusting the intermolecular cohesion energy. The success of this strategy is based on a clear separation of the molecule-substrate interaction from the molecule-molecule interaction. My results show that sufficient molecule-surface anchoring can be achieved without restricting the structural flexibility that is needed for the design of complex molecular systems. Three derivatives of terephthalic acid (TPA) were investigated in chapter 7. Here, the focus was on changing the adhesion to the calcite surface by introducing different anchor functionalities to the TPA backbone. For all observed molecules, the strong substrate templating effect results in molecular structures that are strictly oriented along the calcite main crystal directions. This templating is especially pronounced in the case of 2-ATPA where chain formation on the calcite surface is observed in contrast to the formation of molecular layers in the bulk. At the same time, the amino group of 2-ATPA proved an efficient anchor functionality, successfully stabilizing the molecular chains on the sample surface. These findings emphasizes, once again, the importance of balancing and fine-tuning molecule-molecule and molecule-surface interactions in order to achieve stable, yet structurally flexible molecular arrangements on the sample surface. In the last chapter, I showed how the intrinsic property of molecular chirality decisively influences the structure formation in molecular self-assembly. This effect is especially pronounced in the case of the chiral heptahelicene-2-carboxylic acid. Deposition of the enantiopure molecules results in the formation of homochiral islands on the sample surface which is in sharp contrast to the formation of uni-directional double rows upon deposition of the racemate onto the same surface. While it remained uncertain from these previous experiments whether the double rows are composed of hetero- or homochiral molecules, I could clearly answer that question here and demonstrate that the rows are of heterochiral origin. Chirality, thus, proves to be another important parameter to steer the intermolecular interaction on surfaces. Altogether, the results of this thesis demonstrate that, in order to successfully control the structure formation in molecular self-assembly, the correct combination of molecule and surface properties is crucial. This is of special importance when working on substrates that exhibit a strong influence on the structure formation, such as the calcite(10.4) surface. Through the systematic variation of functional groups several important parameters that influence the balance between molecule-surface and molecule-molecule interaction were identified here, and the results of this thesis can, thus, act as a guideline for the rational design of molecules for use in molecular self-assembly.

Stress abiotici e trattamenti ultra-diluiti: effetti fisiologici e molecolari sulla crescita in vitro di frumento

Gli stress abiotici determinando modificazioni a livello fisiologico, biochimico e molecolare delle piante, costituiscono una delle principali limitazioni per la produzione agricola mondiale. Nel 2007 la FAO ha stimato come solamente il 3,5% della superficie mondiale non sia sottoposta a stress abiotici. Il modello agro-industriale degli ultimi cinquant'anni, oltre ad avere contribuito allo sviluppo economico dell'Europa, è stato anche causa di inquinamento di acqua, aria e suolo, mediante uno sfruttamento indiscriminato delle risorse naturali. L'arsenico in particolare, naturalmente presente nell'ambiente e rilasciato dalle attività antropiche, desta particolare preoccupazione a causa dell'ampia distribuzione come contaminante ambientale e per gli effetti di fitotossicità provocati. In tale contesto, la diffusione di sistemi agricoli a basso impatto rappresenta una importante risorsa per rispondere all'emergenza del cambiamento climatico che negli anni a venire sottoporrà una superficie agricola sempre maggiore a stress di natura abiotica. Nello studio condotto è stato utilizzato uno stabile modello di crescita in vitro per valutare l'efficacia di preparati ultra diluiti (PUD), che non contenendo molecole chimiche di sintesi ben si adattano a sistemi agricoli sostenibili, su semi di frumento preventivamente sottoposti a stress sub-letale da arsenico. Sono state quindi condotte valutazioni sia a livello morfometrico (germinazione, lunghezza di germogli e radici) che molecolare (espressione genica valutata mediante analisi microarray, con validazione tramite Real-Time PCR) arricchendo la letteratura esistente di interessanti risultati. In particolare è stato osservato come lo stress da arsenico, determini una minore vigoria di coleptile e radici e a livello molecolare induca l'attivazione di pathways metabolici per proteggere e difendere le cellule vegetali dai danni derivanti dallo stress; mentre il PUD in esame (As 45x), nel sistema stressato ha indotto un recupero nella vigoria di germoglio e radici e livelli di espressione genica simili a quelli riscontrati nel controllo suggerendo un effetto "riequilibrante" del metabolismo vegetale.

REMOVING TECHNICAL VARIABILITY IN RNA-SEQ DATA USING CONDITIONAL QUANTILE NORMALIZATION

The ability to measure gene expression on a genome-wide scale is one of the most promising accomplishments in molecular biology. Microarrays, the technology that first permitted this, were riddled with problems due to unwanted sources of variability. Many of these problems are now mitigated, after a decade’s worth of statistical methodology development. The recently developed RNA sequencing (RNA-seq) technology has generated much excitement in part due to claims of reduced variability in comparison to microarrays. However, we show RNA-seq data demonstrates unwanted and obscuring variability similar to what was first observed in microarrays. In particular, we find GC-content has a strong sample specific effect on gene expression measurements that, if left uncorrected, leads to false positives in downstream results. We also report on commonly observed data distortions that demonstrate the need for data normalization. Here we describe statistical methodology that improves precision by 42% without loss of accuracy. Our resulting conditional quantile normalization (CQN) algorithm combines robust generalized regression to remove systematic bias introduced by deterministic features such as GC-content, and quantile normalization to correct for global distortions.

Modulation of orientation-selective neurons by motion: when additive, when multiplicative?

The recurrent interaction among orientation-selective neurons in the primary visual cortex (V1) is suited to enhance contours in a noisy visual scene. Motion is known to have a strong pop-up effect in perceiving contours, but how motion-sensitive neurons in V1 support contour detection remains vastly elusive. Here we suggest how the various types of motion-sensitive neurons observed in V1 should be wired together in a micro-circuitry to optimally extract contours in the visual scene. Motion-sensitive neurons can be selective about the direction of motion occurring at some spot or respond equally to all directions (pandirectional). We show that, in the light of figure-ground segregation, direction-selective motion neurons should additively modulate the corresponding orientation-selective neurons with preferred orientation orthogonal to the motion direction. In turn, to maximally enhance contours, pandirectional motion neurons should multiplicatively modulate all orientation-selective neurons with co-localized receptive fields. This multiplicative modulation amplifies the local V1-circuitry among co-aligned orientation-selective neurons for detecting elongated contours. We suggest that the additive modulation by direction-specific motion neurons is achieved through synaptic projections to the somatic region, and the multiplicative modulation by pandirectional motion neurons through projections to the apical region of orientation-specific pyramidal neurons. For the purpose of contour detection, the V1-intrinsic integration of motion information is advantageous over a downstream integration as it exploits the recurrent V1-circuitry designed for that task.

Antitumor activity of an Ets protein, PEA3, in breast cancer cell lines MDA-MB-361DYT2 and BT474M1

Polyomavirus enhancer activator 3 (PEA3) is a member of the Ets family of transcription factors. We demonstrated in a previous study that, through down-regulating the HER-2/neu oncogene at the transcriptional level, PEA3 can inhibit the growth and tumor development of HER-2/neu-overexpressing ovarian cancer cells. Here, we established stable clones of the human breast cancer cell line MDA-MB-361DYT2 that express PEA3 under the control of a tetracycline-inducible promoter. The expression of PEA3 in this cell line inhibited cell growth and resulted in cell cycle delay in the G1 phase independently of the HER-2/neu down-regulation. In an orthotopic breast cancer model, we showed that expression of PEA3 inhibited tumor growth and prolonged the survival of tumor-bearing mice. In a parallel experiment in another breast cancer cell line, BT474M1, we were unable to obtain stable PEA3-inducible transfectants, which suggests that PEA3 possessed a strong growth inhibitory effect in this cell line. Indeed, PEA3 coupled with the liposome SN2 demonstrated therapeutic effects in mice bearing tumors induced by BT474M1. These results provide evidence that the PEA3 gene could function as an antitumor and gene therapy agent for human breast cancers. ^

A common mechanism of defective channel trafficking underlying DFNA2 hearing loss result in different cell surface expression levels of KCNQ4 mutants

KCNQ4 mutations underlie DFNA2, a subtype of autosomal dominant hearing loss. We had previously identified the pore-region p.G296S mutation that impaired channel activity in two manners: it greatly reduced surface expression and abolished channel function. Moreover, G296S mutant exerted a strong dominant-negative effect on potassium currents by reducing the channel expression at the cell surface representing the first study to identify a trafficking-dependent dominant mechanism for the loss of KCNQ4 channel function in DFNA2. Here, we have investigated the pathogenic mechanism associated with all the described KCNQ4 mutations (F182L, W242X, E260K, D262V, L274H, W276S, L281S, G285C, G285S and G321S) that are located in different domains of the channel protein. F182L mutant showed a wild type-like cell-surface distribution in transiently transfected NIH3T3 fibroblasts and the recorded currents in Xenopus oocytes resembled those of the wild-type. The remaining KCNQ4 mutants abolished potassium currents, but displayed distinct levels of defective cell-surface expression in NIH3T3 as quantified by flow citometry. Co-localization studies revealed these mutants were retained in the ER, unless W242X, which showed a clear co-localization with Golgi apparatus. Interestingly, this mutation results in a truncated KCNQ4 protein at the S5 transmembrane domain, before the pore region, that escapes the protein quality control in the ER but does not reach the cell surface at normal levels. Currently we are investigating the trafficking behaviour and electrophysiological properties of several KCNQ4 truncated proteins artificially generated in order to identify specific motifs involved in channel retention/exportation. Altogether, our results indicate that a defect in KCNQ4 trafficking is the common mechanism underlying DFNA2

Structural behaviour and design criteria of under-deck cable-stayed bridges subjected to seismic action

Under-deck cable-stayed bridges are very effective structural systems for which the strong contribution of the stay cables under live loading allows for the design of very slender decks for persistent and transient loading scenarios. Their behaviour when subjected to seismic excitation is investigated herein and a set of design criteria are presented that relate to the type and arrangement of bearings, the number and configuration of struts, and the transverse distribution of stay cables. The nonlinear behaviour of these bridges when subject to both near-field and far-field accelerograms has been thoroughly investigated through the use of incremental dynamic analyses. An intensity measure that reflects the pertinent contributions to response when several vibration modes are activated was proposed and is shown to be effective for the analysis of this structural type. The under-deck cable-stay system contributes in a very positive manner to reducing the response when the bridges are subject to very strong seismic excitation. For such scenarios, the reduction in the stiffness of the deck because of crack formation, when prestressed concrete decks are used, mobilises the cable system and enhances the overall performance of the system. Sets of natural accelerograms that are compliant with the prescriptions of Eurocode 8 were also applied to propose a set of design criteria for this bridge type in areas prone to earthquakes. Particular attention is given to outlining the optimal strategies for the deployment of bearings

A molecular dynamics study of swift heavy ion irradiation of amorphous silica: the role of thermal effects

Irradiation with swift heavy ions (SHI), roughly defined as those having atomic masses larger than 15 and energies exceeding 1 MeV/amu, may lead to significant modification of the irradiated material in a nanometric region around the (straight) ion trajectory (latent tracks). In the case of amorphous silica, SHI irradiation originates nano-tracks of higher density than the virgin material (densification). As a result, the refractive index is increased with respect to that of the surroundings. Moreover, track overlapping leads to continuous amorphous layers that present a significant contrast with respect to the pristine substrate. We have recently demonstrated that SHI irradiation produces a large number of point defects, easily detectable by a number of experimental techniques (work presented in the parallel conference ICDIM). The mechanisms of energy transfer from SHI to the target material have their origin in the high electronic excitation induced in the solid. A number of phenomenological approaches have been employed to describe these mechanisms: coulomb explosion, thermal spike, non-radiative exciton decay, bond weakening. However, a detailed microscopic description is missing due to the difficulty of modeling the time evolution of the electronic excitation. In this work we have employed molecular dynamics (MD) calculations to determine whether the irradiation effects are related to the thermal phenomena described by MD (in the ps domain) or to electronic phenomena (sub-ps domain), e.g., exciton localization. We have carried out simulations of up to 100 ps with large boxes (30x30x8 nm3) using a home-modified version of MDCASK that allows us to define a central hot cylinder (ion track) from which heat flows to the surrounding cold bath (unirradiated sample). We observed that once the cylinder has cooled down, the Si and O coordination numbers are 4 and 2, respectively, as in virgin silica. On the other hand, the density of the (cold) cylinder increases with respect to that of silica and, furthermore, the silica network ring size decreases. Both effects are in agreement with the observed densification. In conclusion, purely thermal effects do not explain the generation of point defects upon irradiation, but they do account for the silica densification.

A coupled proton-transfer and twisting-motion fluorescence probe for lipid bilayers

A new and sensitive molecular probe, 2-(2′-hydroxyphenyl)imidazo[1,2-a]pyridine (HPIP), for monitoring structural changes in lipid bilayers is presented. Migration of HPIP from water into vesicles involves rupture of hydrogen (H) bonds with water and formation of an internal H bond once the probe is inside the vesicle. These structural changes of the dye allow the occurrence of a photoinduced intramolecular proton-transfer reaction and a subsequent twisting/rotational process upon electronic excitation of the probe. The resulting large Stokes-shifted fluorescence band depends on the twisting motion of the zwitterionic phototautomer and is characterized in vesicles of dimyristoyl-phosphatidylcholine and in dipalmitoyl-phosphatidylcholine at the temperature range of interest and in the presence of cholesterol. Because the fluorescence of aqueous HPIP does not interfere in the emission of the probe within the vesicles, HPIP proton-transfer/twisting motion fluorescence directly allows us to monitor and quantify structural changes within bilayers. The static and dynamic fluorescence parameters are sensitive enough to such changes to suggest this photostable dye as a potential molecular probe of the physical properties of lipid bilayers.

Architecture and mechanism of the light-harvesting apparatus of purple bacteria

Photosynthetic organisms fuel their metabolism with light energy and have developed for this purpose an efficient apparatus for harvesting sunlight. The atomic structure of the apparatus, as it evolved in purple bacteria, has been constructed through a combination of x-ray crystallography, electron microscopy, and modeling. The detailed structure and overall architecture reveals a hierarchical aggregate of pigments that utilizes, as shown through femtosecond spectroscopy and quantum physics, elegant and efficient mechanisms for primary light absorption and transfer of electronic excitation toward the photosynthetic reaction center.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Scientific report : RF Project 464 /

1. The determination and interpretation of electronic collision cross sections -- 2. An electron spectrometer for the study of inelastic collision cross sections -- 3. The inelastic scattering of electrons by helium -- 4. Inelastic collision cross sections of carbon monoxide -- 5. An electron impact study of nitrogen in the kinetic energy range 400 to 600 volts -- 6. Electronic collision cross sections and oscillator strengths for oxygen in the Schumann-Runge region -- 7. Electronic collision cross sections for oxygen at excitation energies above 10 volts -- 8. Electronic collsion cross sections for nitrogen at excitation energies from 10 to 80 electron volts -- 9. Additional collision cross sections for helium, especially in the ionized continuum -- 10. A collision cross section study of CO₂, with a theoretical study of two transitions -- 11. Further developments in the theory and use of the electron spectrometer -- 12. Electronic collision cross sections of water vapor.