994 resultados para ruthenium complex
Resumo:
A novel diimine Cu(I)complex [Cu(ABPQ)(DPEphos)]BF4 [ABPQ and DPEphos are acenaphtho[1,2-b]bipyrido[2,3-h:3,2-f]quinoxaline and bis(2-(diphenylphosphanyl)phenyl) ether, respectively] is synthesized, and its photophysical properties are experimentally and theoretically characterized. The emission bands centered at ca. 400/470 and 550 nm of [Cu(ABPQ)(DPEphos)]BF4 are attributed to the ligand-centered pi -> pi* transition and the metal-to-ligand charge transfer d pi(Cu) -> pi*(N-N) transition, respectively. The luminescence quantum yield of [Cu(ABPQ)(DPEphos)]BF4 in CHCl3 is found to be about five times higher than that of [Cu(Phen)(DPEphos)]BF4.
Resumo:
A series of oligoaniline-functionalized mono- and bis-topic terpyridine ligands, i.e. C6H5[N(R)C6H4](n)TPY (R = H, butyl, tert-butyloxycarbonyl; n = 1-4; TPY = 2,2':6',2"-terpyridyl) and TPYC6H4[N(R)C6H4](m)TPY (R = H, tert-butyloxycarbonyl; m = 2, 4), and the corresponding monoand bis-nuclear ruthenium(II) complexes have been synthesized and verified. The spectroscopic results indicate that two kinds of pi-pi* transitions from TPY and oligoaniline fragments of ligands strongly shift to lower energy, and the metal-to-ligand charge-transfer transition ((MLCT)-M-1) bands of all obtained complexes are considerably red-shifted (Delta lambda(max) = 22-64 nm) and their intensities become much more intense (approximately 4-6 times), compared with those of the reported complex [Ru(TPY)(2)](2+). Moreover, the spectroscopic properties of the ligands and complexes with longer oligoaniline units (n = 3, 4) are markedly influenced by the external stimulus, such as the oxidation and proton acid doping.
Resumo:
Luminescent heteroleptic Cu-I complexes based on asymmetrical iminephosphine ligands exhibit improved electrochemical and photochemical stability as compared to the analogous complexes based on traditional diimine or diphosphine ligands.
Resumo:
An approach was reported to synthesize silica hybridized ruthenium bipyridyl complex through amidation reaction by covalent attachment of bis(bipyridyl)-4,4'-dicarboxy-2,2'-bipyridyl-ruthenium to (3-aminopropyl)-triethoxysilane. The hybrid complex then was gelatinized through acid catalytic hydrolysis method and a sol-gel modified indium, tin oxide electrode was prepared via spin coating technique. As prepared indium tin oxide electrode possesses good stability therein with excellent electrochemiluminescence behavior.
Resumo:
Zinc(II)-2-(2-hydroxyphenyl)benzothiazolate complex is an excellent white-light-emitting material. Despite some studies devoted to this complex, no information on the real origin of the unusually broad electroluminescent (EL) emission is available. Therefore, we investigate photoluminescent and EL properties of the zinc complex. Orange phosphorescent emission at 580 nm was observed for the complex in thin film at 77 K, whereas only fluorescent emission was obtained at room temperature. Molecular orbitals, excitation energy, and emission energy of the complex were investigated using quantum chemical calculations. We fabricated the device with a structure of ITO/F16CuPc(5.5 nm)/Zn-complex/Al, where F16CuPc is hexadecafluoro copper phthalocyanine. The EL spectra varied strongly with the thickness of the emissive layer. We observed a significant change in the emission spectra with the viewing angles. Optical interference effects and light emission originating both from fluorescence and from phosphorescence can explain all of the observed phenomena, resulting in the broad light emission for the devices based on the Zn complex. We calculated the charge transfer integral and the reorganization energy to explain why the Zn complex is a better electron transporter than a hole transporter.
Resumo:
In this paper, a simple method of preparing {SiO2/Ru-(bPY)(3)(2+)}(n) multilayer films was described. Positively charged tris(2,2'-bipyridyl)ruthenium(II) (Ru(bpy)(3)(2+)) and negatively charged SiO2 nanoparticles were assembled on ITO electrodes by a layer-by-layer method. Electrochemical and electrogenerated chemiluminescence (ECL) behaviors of the {SiO2/Ru(bpy)(3)(2+)}(n) multilayer film-modified electrodes were studied. Cyclic voltammetry, UV-visible spectroscopy, quartz crystal microbalance, and ECL were adopted to monitor the regular growth of the multilayer films. The multilayer films containing Ru(bpy)(3)(2+) was used for ECL determination of TPA, and the sensitivity was more than 1 order of magnitude higher than that observed for previous reported immobilization methods for the determination of TPA. The multilayer films also showed better stability for one month at least. The high sensitivity and stability mainly resulted from the high surface area and special structure of the silica nanoparticles.
Resumo:
We report on the preparation of luminescent silica mesoporous molecular sieves (MCM-48) activated by the europium complex Eu(DBM)(3) . 2H(2)O (where DBM = dibenzoylmethane), using a simple wet impregnation method. Different concentrations of Eu(DBM)(3) . 2H(2)O were introduced into the MCM-48 cubic structure, and the resulting samples were washed with ethanol for different times. UV-Vis absorption measurements and thermogravimetric analysis were used to estimate the amount of Eu complex that has been incorporated within the pores of the MCM-48 host. The various samples were characterized by X-ray powder diffraction (XRD), infrared spectroscopy, diffuse reflectance (DR) and fluorescence measurements. The results reveal that Eu complexes have been successfully introduced into the pores of MCM-48 without disrupting the structure. All the impregnated MCM-48 materials show the typical red luminescence of Eu3+ when excited with a UV lamp. Shifts of the absorption maxima were observed in the DR and fluorescence excitation spectra and will be discussed in relation with guest-host interactions between the organic complex and the silica matrix. The decay profiles of the europium luminescence in the different samples were also measured and discussed.
Resumo:
The efficient synthesis of 5-(5-bromovaleramido)-1,10-phenanthroline, 5-(6-bromohexanamido)-1,10-phenanthroline, and 5-(11-bromoundecanamido)-1,10-phenanthroline are described, which reacted with cis-Ru(bpy)(2)Cl-2. 2H(2)O and sodium hexafluorophosphate to form Ru(bpy)(2)[phen-NHCO(CH2)(n)Br](PF6)(2) (n = 4, 5 or 10; phen = 1,10-phenanthroline). The intricate H-1 NMR spectra at low field of these complexes were completely assigned in virtue of H-1-H-1 COSY technique. Cyclic voltammetry was used to study electrochemical behaviours of these complexes, and their luminescent properties were investigated with fluorescent spectra.
Resumo:
The present paper covers the syntheses of 1,8-adipoylamido-bis(1,10-phenanthroline-5-yl)(bphaa) and its binuclear complex {[(bpy)(2)Ru](2)(bphaa)} (PF6)(4), where bpy is 2,2'-bipyridine. The two novel compounds were confirmed by means of elemental analysis, IR, and LD-MS and H-1 NMR, and H-1 NMR spectra were completely assigned in virtue of H-1-H-1 COSY. chemical behavior of the binuclear Ru (I) complex was obtained using cyclic and voltammetry. Its photophysical property was investigated by electronic absorption, excitation and emission spectra.
Resumo:
Self-assembly of tris-[2,2 ' -bipyridine]ruthenium(II) chloride with decatunstate produced a novel cation radical salt, [Ru(bpy)(3)](2)[W10O32] . 3DMSO. This is the first product of 2,2 ' -bipyridineruthenium(II)-polyoxometalates species. Crystal data: Monoclinic, P2(1)/c, a = 12.902(3) Angstrom, b = 21.487(3) Angstrom, c = 15.854(5) Angstrom, beta = 93.46(2)degrees, V = 4387(2) Angstrom (3), Z = 2, R-1 = 0.0599, wR2 = 0.1183. X-ray crystallographic study showed that the crystal structure was constructed by electyrostatic attraction and C-H . . .O hydrogen bonds between tris-[2,2 ' -bipyridine]ruthenium(II) and decatungstate polyanion. The tris-[2,2 ' -bipyridine]ruthenium molecules occupy cavities in the polyoxometalate lattice ordered along b-axis. (C) 2001 Elsevier Science B.V. All rights reserved.
Resumo:
The (1) H and C-13 NMR spectra are reported for Ru(4, 4'-dimethyl-2,2'-bipyridene)(2) (2,2'-bipyridine-4,4'-dicarboxylic acid) (PF6)(2) that can be used as a new electrochemiluminescent probe in immunoasssay and nucleic acid hybridization assay. Because of the effect ol:Ru atom ligands and complex steric configuration, it is difficult to attribute spectra of the title molecular, By using 2D (1) H-(1) H COSY and (1) H-C-13 HETCOR method, the proton and C-13 NMR spectra are assigned completely, which provides a satisfactory method to quantitative and qualitative, analysis of the title moleculer in the further study.
Resumo:
The synthesis and characterisation of a new bifunctional Ru(II) complex are presented. This compound contains a metallic unit, photo-reactive versus the guanines of DNA, and a new bifunctional ligand. An intramolecular luminescence quenching makes this complex an attractive candidate for photoprobing DNA where the intramolecular quenching process is inhibited with restoration of luminescence. © 1998 Elsevier Science S.A. All rights reserved.
Resumo:
The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.
Resumo:
Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.