963 resultados para mRNA


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Interferon (IFN)-alpha receptor mRNA expression in liver of patients with chronic hepatitis C has been shown to be a response to IFN-alpha therapy. The objective of the present study was to determine whether the expression of mRNA for subunit 1 of the IFN-alpha receptor (IFNAR1) in peripheral blood mononuclear cells (PBMC) is associated with the response to IFN-alpha in patients with chronic hepatitis C. Thirty patients with positive anti-HCV and HCV-RNA, and abnormal levels of alanine aminotransferase in serum were selected and treated with IFN-alpha2b for one year. Those with HBV or HIV infection, or using alcohol were not included. Thirteen discontinued the treatment and were not evaluated. The IFN-alpha response was monitored on the basis of alanine aminotransferase level and positivity for HCV-RNA in serum. IFNAR1-mRNA expression in PBMC was measured by reverse transcription-polymerase chain reaction before and during the first three months of therapy. The results are reported as IFNAR1-mRNA/ß-actin-mRNA ratio (mean ± SD). Before treatment, responder patients had significantly higher IFNAR1-mRNA expression in PBMC (0.67 ± 0.15; N = 5; P < 0.05) compared to non-responders (0.35 ± 0.17; N = 12) and controls (0.30 ± 0.16; N = 9). Moreover, IFNAR1-mRNA levels were significantly reduced after 3 months of treatment in responders, whereas there were no differences in IFNAR1 expression in non-responders during IFN-alpha therapy. Basal IFNAR1-mRNA expression was not correlated with the serum level of alanine and aspartate aminotransferases or the presence of cirrhosis. The present results suggest that IFNAR1-mRNA expression in PBMC is associated with IFN-alpha response to hepatitis C and may be useful for monitoring therapy in patients with chronic hepatitis C.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the present study was to assess the effects of endurance training on leptin levels and adipose tissue gene expression and their association with insulin, body composition and energy intake. Male Wistar rats were randomly divided into two groups: trained (N = 18) and sedentary controls (N = 20). The trained group underwent swimming training for 9 weeks. Leptin and insulin levels, adiposity and leptin gene expression in epididymal and inguinal adipose tissue were determined after training. There were no differences in energy intake between groups. Trained rats had a decreased final body weight (-10%), relative and total body fat (-36 and -55%, respectively) and insulin levels (-55%) compared with controls (P < 0.05). Although trained animals showed 56% lower leptin levels (2.58 ± 1.05 vs 5.89 ± 2.89 ng/mL in control; P < 0.05), no difference in leptin gene expression in either fat depot was demonstrable between groups. Stepwise multiple regression analysis showed that lower leptin levels in trained rats were due primarily to their lower body fat mass. After adjustment for total body fat, leptin levels were still 20% (P < 0.05) lower in exercised rats. In conclusion, nine weeks of swimming training did not affect leptin gene expression, but did lead to a decrease in leptin levels that was independent of changes in body fat.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Female rats are intensely affected by cocaine, with estrogen probably playing an important role in this effect. Progesterone modulates the GABA system and attenuates the effects of cocaine; however, there is no information about its relevance in changing GABA synthesis pathways after cocaine administration to female rats. Our objective was to investigate the influence of progesterone on the effects of repeated cocaine administration on the isoenzymes of glutamic acid decarboxylase (GAD65 and GAD67) mRNA in brain areas involved in the addiction circuitry. Ovariectomized, intact and progesterone replacement-treated female rats received saline or cocaine (30 mg/kg, ip) acutely or repeatedly. GAD isoenzyme mRNA levels were determined in the dorsolateral striatum (dSTR) and prefrontal cortex (PFC) by RT-PCR, showing that repeated, but not acute, cocaine decreased GADs/β-actin mRNA ratio in the dSTR irrespective of the hormonal condition (GAD65: P < 0.001; and GAD67: P = 0.004). In the PFC, repeated cocaine decreased GAD65 and increased GAD67 mRNA ratio (P < 0.05). Progesterone replacement decreased both GAD isoenzymes mRNA ratio after acute cocaine in the PFC (P < 0.001) and repeated cocaine treatment reversed this decrease (P < 0.001). These results suggest that cocaine does not immediately affect GAD mRNA expression, while repeated cocaine decreases both GAD65 and GAD67 mRNA in the dSTR of female rats, independently of their hormonal conditions. In the PFC, repeated cocaine increases the expression of GAD isoenzymes, which were decreased due to progesterone replacement.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Estradiol participates in the control of energy homeostasis, as demonstrated by an increase in food intake and in body weight gain after ovariectomy in rats. In the present study, female Wistar rats (200-230 g, N = 5-15 per group), with free access to chow, were individually housed in metabolic cages. We investigated food intake, body weight, plasma leptin levels, measured by specific radioimmunoassay, and the hypothalamic mRNA expression of orexigenic and anorexigenic neuropeptides, determined by real-time PCR, in ovariectomized rats with (OVX+E) and without (OVX) estradiol cypionate treatment (10 µg/kg body weight, sc, for 8 days). Hormonal and mRNA expression were determined at pre-feeding and 4 h after food intake. OVX+E rats showed lower food intake, less body weight gain and lower plasma leptin levels. In the OVX+E group, we also observed a reduction of neuropeptide Y (NPY), agouti-related protein (AgRP) and cocaine- and amphetamine-regulated transcript (CART) mRNA expression in the arcuate nucleus and a decrease in orexin A in the lateral hypothalamic area (LHA). There was an increase in leptin receptor (LepRb), melanocortin-4 receptor (MC4-R), CART, and mainly corticotropin-releasing hormone (CRH) mRNA in the paraventricular nucleus and LepRb and CART mRNA in the LHA. These data show that hypophagia induced by estradiol treatment is associated with reduced hypothalamic expression of orexigenic peptides such as NPY, AgRP and orexin A, and increased expression of the anorexigenic mediators MC4-R, LepRb and CRH. In conclusion, estradiol decreases food intake, and this effect seems to be mediated by peripheral factors such as leptin and the differential mRNA expression of neuropeptides in the hypothalamus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The actions of thyroid hormone (TH) on pancreatic beta cells have not been thoroughly explored, with current knowledge being limited to the modulation of insulin secretion in response to glucose, and beta cell viability by regulation of pro-mitotic and pro-apoptotic factors. Therefore, the effects of TH on proinsulin gene expression are not known. This led us to measure: a) proinsulin mRNA expression, b) proinsulin transcripts and eEF1A protein binding to the actin cytoskeleton, c) actin cytoskeleton arrangement, and d) proinsulin mRNA poly(A) tail length modulation in INS-1E cells cultured in different media containing: i) normal fetal bovine serum - FBS (control); ii) normal FBS plus 1 µM or 10 nM T3, for 12 h, and iii) FBS depleted of TH for 24 h (Tx). A decrease in proinsulin mRNA content and attachment to the cytoskeleton were observed in hypothyroid (Tx) beta cells. The amount of eEF1A protein anchored to the cytoskeleton was also reduced in hypothyroidism, and it is worth mentioning that eEF1A is essential to attach transcripts to the cytoskeleton, which might modulate their stability and rate of translation. Proinsulin poly(A) tail length and cytoskeleton arrangement remained unchanged in hypothyroidism. T3 treatment of control cells for 12 h did not induce any changes in the parameters studied. The data indicate that TH is important for proinsulin mRNA expression and translation, since its total amount and attachment to the cytoskeleton are decreased in hypothyroid beta cells, providing evidence that effects of TH on carbohydrate metabolism also include the control of proinsulin gene expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Most human genes undergo alternative splicing and loss of splicing fidelity is associated with disease. Epigenetic silencing of hMLH 1 via promoter cytosine methylation is causally linked to a subset of sporadic non-polyposis colon cancer and is reversible by 5-aza-2' -deoxycytidine treatment. Here I investigated changes in hMLHI mRNA splicing profiles in normal fibroblasts and colon cancer-derived human cell lines. I established the types and frequencies of hMLHI mRNA transcripts generated under baseline conditions, after hydrogen peroxide induced oxidative stress, and in acutely 5-aza-2' -deoxycytidine-treated and stably derepressed cancer cell lines. I found that hMLHI is extensively spliced under all conditions including baseline (50% splice variants), the splice variant distribution changes in response to oxidative stress, and certain splice variants are sensitive to 5- aza-2' -deoxycytidine treatment: Splice variant diversity and frequency of exon 17 skipping correlates with the level of hMLHI promoter methylation suggesting a link between promoter methylation and mRNA splicing.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Le transport et la localisation des ARN messagers permettent de réguler l’expression spatiale et temporelle de facteurs spécifiques impliqués dans la détermination du destin cellulaire, la plasticité synaptique, la polarité cellulaire et la division asymétrique des cellules. Chez S.cerevisiæ, plus de trente transcrits sont transportés activement vers le bourgeon cellulaire. Parmi ces transcrits, l’ARNm ASH1 (asymetric synthesis of HO) est localisé à l’extrémité du bourgeon pendant l’anaphase. Ce processus va entrainer une localisation asymétrique de la protéine Ash1p, qui sera importée uniquement dans le noyau de la cellule fille, où elle entraine le changement de type sexuel. La localisation asymétrique de l’ARNm ASH1, et donc de Ash1p, implique la présence de différents facteurs de localisation. Parmi ces facteurs, les protéines She (She1p/Myo4p, She2p et She3p) et les répresseurs traductionnels (Puf6p, Loc1p et Khd1p) participent à ce mécanisme. La protéine navette She2p est capable de lier l’ARNm ASH1 et va entrainer le ciblage de cet ARNm vers l’extrémité du bourgeon en recrutant le complexe She3p-Myo4p. Des répresseurs traductionnels régulent la traduction de cet ARNm et évitent l’expression ectopique de la protéine Ash1p pendant son transport. Alors que la fonction cytoplasmique de She2p sur la localisation des ARNm est connue, sa fonction nucléaire est encore inconnue. Nous avons montré que She2p contient une séquence de localisation nucléaire non classique qui est essentielle à son import nucléaire médié par l’importine α (Srp1p). L’exclusion de She2p du noyau par mutation de son NLS empêche la liaison de Loc1p et Puf6p sur l’ARNm ASH1, entrainant un défaut de localisation de l’ARNm et de la protéine. Pour étudier plus en détail l’assemblage de la machinerie de localisation des ARNm dans le noyau, nous avons utilisé des techniques d’immunoprécipitation de chromatine afin de suivre le recrutement des facteurs de localisation et des répresseurs traductionnels sur les ARNm naissants. Nous avons montré que She2p est recruté sur le gène ASH1 pendant sa transcription, via son interaction avec l’ARNm ASH1 naissant. Puf6p est également recruté sur ASH1, mais d’une manière dépendante de la présence de She2p. De façon intéressante, nous avons détecté une interaction entre She2p et la plus grande sous-unité de l’ARN polymérase II (Rpb1p). Cette interaction est détectée avec la forme active en élongation de l’ARN polymérase II. Nous avons également démontré que She2p interagit avec le complexe d’élongation de la transcription Spt4p/Spt5p. Une délétion de SPT4 ou une mutation dans SPT5 (Ts spt5) à température restrictive empêche l’interaction entre She2p et Rpb1p, et diminue le recrutement de She2p au gène ASH1, entrainant un défaut de localisation de l’ARNm et un défaut de localisation asymétrique de la protéine Ash1p. De manière globale, nos résultats montrent que les facteurs impliqués dans la localisation cytoplasmique des ARNm et dans leur contrôle traductionnel sont recrutés de façon co-transcriptionnelle sur les ARNm naissants via leur interaction avec la machinerie de transcription, suggèrant un rôle important de la machinerie transcriptionelle dans la localisation des ARNm.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mémoire numérisé par la Division de la gestion de documents et des archives de l'Université de Montréal

Relevância:

20.00% 20.00%

Publicador:

Resumo:

La quantité de données générée dans le cadre d'étude à grande échelle du réseau d'interaction protéine-protéine dépasse notre capacité à les analyser et à comprendre leur sens; d'une part, par leur complexité et leur volume, et d'un autre part, par la qualité du jeu de donnée produit qui semble bondé de faux positifs et de faux négatifs. Cette dissertation décrit une nouvelle méthode de criblage des interactions physique entre protéines à haut débit chez Saccharomyces cerevisiae, la complémentation de fragments protéiques (PCA). Cette approche est accomplie dans des cellules intactes dans les conditions natives des protéines; sous leur promoteur endogène et dans le respect des contextes de modifications post-traductionnelles et de localisations subcellulaires. Une application biologique de cette méthode a permis de démontrer la capacité de ce système rapporteur à répondre aux questions d'adaptation cellulaire à des stress, comme la famine en nutriments et un traitement à une drogue. Dans le premier chapitre de cette dissertation, nous avons présenté un criblage des paires d'interactions entre les protéines résultant des quelques 6000 cadres de lecture de Saccharomyces cerevisiae. Nous avons identifié 2770 interactions entre 1124 protéines. Nous avons estimé la qualité de notre criblage en le comparant à d'autres banques d'interaction. Nous avons réalisé que la majorité de nos interactions sont nouvelles, alors que le chevauchement avec les données des autres méthodes est large. Nous avons pris cette opportunité pour caractériser les facteurs déterminants dans la détection d'une interaction par PCA. Nous avons remarqué que notre approche est sous une contrainte stérique provenant de la nécessité des fragments rapporteurs à pouvoir se rejoindre dans l'espace cellulaire afin de récupérer l'activité observable de la sonde d'interaction. L'intégration de nos résultats aux connaissances des dynamiques de régulations génétiques et des modifications protéiques nous dirigera vers une meilleure compréhension des processus cellulaires complexes orchestrés aux niveaux moléculaires et structuraux dans les cellules vivantes. Nous avons appliqué notre méthode aux réarrangements dynamiques opérant durant l'adaptation de la cellule à des stress, comme la famine en nutriments et le traitement à une drogue. Cette investigation fait le détail de notre second chapitre. Nous avons déterminé de cette manière que l'équilibre entre les formes phosphorylées et déphosphorylées de l'arginine méthyltransférase de Saccharomyces cerevisiae, Hmt1, régulait du même coup sont assemblage en hexamère et son activité enzymatique. L'activité d'Hmt1 a directement un impact dans la progression du cycle cellulaire durant un stress, stabilisant les transcrits de CLB2 et permettant la synthèse de Cln3p. Nous avons utilisé notre criblage afin de déterminer les régulateurs de la phosphorylation d'Hmt1 dans un contexte de traitement à la rapamycin, un inhibiteur de la kinase cible de la rapamycin (TOR). Nous avons identifié la sous-unité catalytique de la phosphatase PP2a, Pph22, activé par l'inhibition de la kinase TOR et la kinase Dbf2, activé durant l'entrée en mitose de la cellule, comme la phosphatase et la kinase responsable de la modification d'Hmt1 et de ses fonctions de régulations dans le cycle cellulaire. Cette approche peut être généralisée afin d'identifier et de lier mécanistiquement les gènes, incluant ceux n'ayant aucune fonction connue, à tout processus cellulaire, comme les mécanismes régulant l'ARNm.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the last few years, the development of a plasmid-based reverse genetics system for mammalian reovirus has allowed the production and characterization of mutant viruses. This could be especially significant in the optimization of reovirus strains for virotherapeutic applications, either as gene vectors or oncolytic viruses. The genome of a mutant virus exhibiting increased sensitivity to interferon was completely sequenced and compared with its parental virus. Viruses corresponding to either the parental or mutant viruses were then rescued by reverse genetics and shown to exhibit the expected phenotypes. Systematic rescue of different viruses harboring either of the four parental genes in a mutant virus backbone, or reciprocally, indicated that a single amino acid substitution in one of λ2 methyltransferase domains is the major determinant of the difference in interferon sensitivity between these two viruses.