Comparison of DNA-extraction methods and Selective Enrichment broths on the detection of Salmonella Typhimurium in swine feces by polymerase chain reaction (PCR)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação de volumes de calda proporcionados por diferentes pontas de pulverização no controle de Tuta absoluta (Meirick, 1917) (Lepidoptera: Gelechiidae) em tomate rasteiro

O objetivo deste trabalho foi avaliar o controle da traça-do-tomateiro em função dos volumes de aplicação. O levantamento da infestação da praga foi realizado avaliando-se o número de lagartas e de lesões com e sem lagarta viva e o número de ovos em folhas e frutos. Os tratamentos realizados foram o inseticida chlorfluazuron na dosagem de 80 mL p.c. 100 L-1, aplicado com as pontas: TJ6011002, TJ6011004, TX04VK e TX12VK cada uma utilizando, respectivamente, o volume de calda de: 200, 600, 200 e 600 L ha-1; e o pulverizador costal motorizado (100 L ha-1); todos com e sem o adjuvante polioxietileno alquil fenol éter (1 mL 10 L-1 de água) e mais uma testemunha. Verificou-se que os tratamentos com e sem adjuvantes não diferiram entre si. Porém, houve diferença entre os volumes utilizados, sendo menor a ocorrência de lesões nas parcelas tratadas com o volume de 600 L ha-1 . Houve também diferença em relação ao uso do adjuvante para o volume de 200 L ha-1 , sendo que o número de ovos foi superior sem a sua utilização. Neste trabalho, foi observada a importância do monitoramento no controle de pragas.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Desenvolvimento de um reator fotoquímico aplicável no tratamento de efluentes fenólicos presentes na indústria do petróleo

With water pollution increment at the last years, so many progresses in researches about treatment of contaminated waters have been developed. In wastewaters containing highly toxic organic compounds, which the biological treatment cannot be applied, the Advanced Oxidation Processes (AOP) is an alternative for degradation of nonbiodegradable and toxic organic substances, because theses processes are generation of hydroxyl radical based on, a highly reactivate substance, with ability to degradate practically all classes of organic compounds. In general, the AOP request use of special ultraviolet (UV) lamps into the reactors. These lamps present a high electric power demand, consisting one of the largest problems for the application of these processes in industrial scale. This work involves the development of a new photochemistry reactor composed of 12 low cost black light fluorescent lamps (SYLVANIA, black light, 40 W) as UV radiation source. The studied process was the photo-Fenton system, a combination of ferrous ions, hydrogen peroxide, and UV radiation, it has been employed for the degradation of a synthetic wastewater containing phenol as pollutant model, one of the main pollutants in the petroleum industry. Preliminary experiments were carrier on to estimate operational conditions of the reactor, besides the effects of the intensity of radiation source and lamp distribution into the reactor. Samples were collected during the experiments and analyzed for determining to dissolved organic carbon (DOC) content, using a TOC analyzer Shimadzu 5000A. The High Performance Liquid Chromatography (HPLC) was also used for identification of the cathecol and hydroquinone formed during the degradation process of the phenol. The actinometry indicated 9,06⋅1018 foton⋅s-1 of photons flow, for 12 actived lamps. A factorial experimental design was elaborated which it was possible to evaluate the influence of the reactants concentration (Fe2+ and H2O2) and to determine the most favorable experimental conditions ([Fe2+] = 1,6 mM and [H2O2] = 150,5 mM). It was verified the increase of ferrous ions concentration is favorable to process until reaching a limit when the increase of ferrous ions presents a negative effect. The H2O2 exhibited a positive effect, however, in high concentrations, reaching a maximum ratio degradation. The mathematical modeling of the process was accomplished using the artificial neural network technique

Extração do corante reactive blue 19 utilizando tensoativo não iônico

The generation of effluent from the finishing process in textile industry is a serious environmental problem and turned into an object of study in several scientific papers. Contamination with dyes and the presences of substances that are toxic to the environment characterize this difficult treatment effluent. Several processes have already been evaluated to remove and even degrade such pollutants are examples: coagulation-flocculation, biological treatment and advanced oxidative processes, but not yet sufficient to enable the recovery of dye or at least of the recovery agent. An alternative to this problem is the cloud point extraction that involves the application of nonionic surfactants at temperatures above the cloud point, making the water a weak solvent to the surfactant, providing the agglomeration of those molecules around the dyes molecules by affinity with the organic phase. After that, the formation of two phases occurred: the diluted one, poor in dye and surfactant, and the other one, coacervate, with higher concentrations of dye and surfactants than the other one. The later use of the coacervate as a dye and surfactant recycle shows the technical and economic viability of this process. In this paper, the cloud point extraction is used to remove the dye Reactive Blue from the water, using nonionic surfactant nonyl phenol with 9,5 etoxilations. The aim is to solubilize the dye molecules in surfactant, varying the concentration and temperature to study its effects. Evaluating the dye concentration in dilute phase after extraction, it is possible to analyze thermodynamic variables, build Langmuir isotherms, determine the behavior of the coacervate volume for a surfactant concentration and temperature, the distribution coefficient and the dye removal efficiency. The concentration of surfactant proved itself to be crucial to the success of the treatment. The results of removal efficiency reached values of 91,38%, 90,69%, 89,58%, 87,22% and 84,18% to temperatures of 65,0, 67,5, 70,0, 72,5 and 75,0°C, respectively, showing that the cloud point extraction is an efficient alternative for the treatment of wastewater containing Reactive Blue

Estudo da influência da temperatura na degradação termoquímica da biomassa de avelós

The bio-oil obtained from the pyrolysis of biomass has appeared as inter-esting alternative to replace fossil fuels. The aim of this work is to evaluate the influence of temperature on the yield of products originating from the pyrolysis process of the powder obtained from the dried twigs of avelós (Euphorbia tirucalli), using a rotating cylinder reactor in laboratory scale. The biomass was treated and characterized by: CHNS, moisture, volatiles, fixed carbon and ashes, as well as evaluation of lignin, cellulose and hemicellulose, besides other instrumental techniques such as: FTIR, TG/DTG, DRX, FRX and MEV. The activation energy was evaluated in non-isothemichal mode with heating rates of 5 and 10 oC/min. The obtained results showed biomass as feedstock with potential for biofuel production, because presents a high organic matter content (78,3%) and fixed-carbon (7,11%). The activation energy required for the degradation of biomass ranged between 232,92 392,84 kJ/mol, in the temperature range studied and heating rate of 5 and 10°C/min. In the pyrolysis process, the influence of the reaction temperature was studied (350-520 ° C), keeping constant the other variables, such as, the flow rate of carrier gas, the centrifugal speed for the bio-oil condensationa, the biomass flow and the rotation of the reactor. The maximum yield of bio-oil was obtained in the temperature of 450°C. In this temperature, the results achieved where: content of bio-oil 8,12%; char 32,7%; non-condensed gas 35,4%; losts 23,8%; gross calorific value 3,43MJ/kg; pH 4,93 and viscosity 1,5cP. The chromatographic analysis of the bio-oil produced under these conditions shows mainly the presence of phenol (17,71%), methylciclopentenone (10,56%) and dimethylciclopentenone (7,76%)

Estudo da influência da temperatura na degradação termoquímica da biomassa de avelós (euphorbia tirucalli Linn)

The bio-oil obtained from the pyrolysis of biomass has appeared as inter-esting alternative to replace fossil fuels. The aim of this work is to evaluate the influence of temperature on the yield of products originating from the pyrolysis process of the powder obtained from the dried twigs of avelós (Euphorbia tirucalli), using a rotating cylinder reactor in laboratory scale. The biomass was treated and characterized by: CHNS, moisture, volatiles, fixed carbon and ashes, as well as evaluation of lignin, cellulose and hemicellulose, besides other instrumental techniques such as: FTIR, TG/DTG, DRX, FRX and MEV. The activation energy was evaluated in non-isothemichal mode with heating rates of 5 and 10 oC/min. The obtained results showed biomass as feedstock with potential for biofuel production, because presents a high organic matter content (78,3%) and fixed-carbon (7,11%). The activation energy required for the degradation of biomass ranged between 232,92 392,84 kJ/mol, in the temperature range studied and heating rate of 5 and 10°C/min. In the pyrolysis process, the influence of the reaction temperature was studied (350-520 ° C), keeping constant the other variables, such as, the flow rate of carrier gas, the centrifugal speed for the bio-oil condensationa, the biomass flow and the rotation of the reactor. The maximum yield of bio-oil was obtained in the temperature of 450°C. In this temperature, the results achieved where: content of bio-oil 8,12%; char 32,7%; non-condensed gas 35,4%; losts 23,8%; gross calorific value 3,43MJ/kg; pH 4,93 and viscosity 1,5cP. The chromatographic analysis of the bio-oil produced under these conditions shows mainly the presence of phenol (17,71%), methylciclopentenone (10,56%) and dimethylciclopentenone (7,76%)

Determinação de dados de equilíbrio de fases para sistemas aquosos com eletrólitos

In the present work are established initially the fundamental relationships of thermodynamics that govern the equilibrium between phases, the models used for the description of the behavior non ideal of the liquid and vapor phases in conditions of low pressures. This work seeks the determination of vapor-liquid equilibrium (VLE) data for a series of multicomponents mixtures of saturated aliphatic hydrocarbons, prepared synthetically starting from substances with analytical degree and the development of a new dynamic cell with circulation of the vapor phase. The apparatus and experimental procedures developed are described and applied for the determination of VLE data. VLE isobarics data were obtained through a Fischer s ebulliometer of circulation of both phases, for the systems pentane + dodecane, heptane + dodecane and decane + dodecane. Using the two new dynamic cells especially projected, of easy operation and low cost, with circulation of the vapor phase, data for the systems heptane + decane + dodecane, acetone + water, tween 20 + dodecane, phenol + water and distillation curves of a gasoline without addictive were measured. Compositions of the equilibrium phases were found by densimetry, chromatography, and total organic carbon analyzer. Calibration curves of density versus composition were prepared from synthetic mixtures and the behavior excess volumes were evaluated. The VLE data obtained experimentally for the hydrocarbon and aqueous systems were submitted to the test of thermodynamic consistency, as well as the obtained from the literature data for another binary systems, mainly in the bank DDB (Dortmund Data Bank), where the Gibbs-Duhem equation is used obtaining a satisfactory data base. The results of the thermodynamic consistency tests for the binary and ternary systems were evaluated in terms of deviations for applications such as model development. Later, those groups of data (tested and approved) were used in the KijPoly program for the determination of the binary kij parameters of the cubic equations of state original Peng-Robinson and with the expanded alpha function. These obtained parameters can be applied for simulation of the reservoirs petroleum conditions and of the several distillation processes found in the petrochemistry industry, through simulators. The two designed dynamic cells used equipments of national technology for the determination of VLE data were well succeed, demonstrating efficiency and low cost. Multicomponents systems, mixtures of components of different molecular weights and also diluted solutions may be studied in these developed VLE cells

Estudo da influência de compostos recalcitrantes na remoção de matéria orgânica biodegradável no tratamento de efluente de refinarias de petróleo

Petroleum Refinery wastewaters (PRW) have hart-to-degrade compounds, such as: phenols, ammonia, cyanides, sulfides, oils and greases and the mono and polynuclear aromatic hydrocarbons: benzene, toluene and xylene (BTX), acenaphthene, nitrobenzene and naphtalene. It is known that the microrganisms activity can be reduced in the presence of certain substances, adversely affecting the biological process of wastewater treatment. This research was instigated due the small number of studies regarding to this specific topic in the avaiable literature. This body of work ims to evaluate the effect of toxic substances on the biodegradability of the organic material found in PRW. Glucose was chosen as the model substrate due to its biodegradable nature. This study was divided into three parts: i) a survey of recalcitants compounds and the removal of phenol by using both biological and photochemical-biological processes; ii) biomass aclimation and iii) evaluation of the inhibitory effect certain compounds have on glucose biodegradation. The phenol degradation experiments were carried out in an activity sludge system and in a photochemical reactor. The results showed the photochemical-biological process to be more effective on phenol degradation, suggesting the superioruty of a combined photochemical-biological treatment when compared with a simple biological process for phenol removal from industry wastewaters. For the acclimation step, was used an activated sludge from industrial wastewaters. A rapid biomass aclimation to a synthetic solution composed of the main inhibitory compouns fpund in a PRW was obtained using the following operation condition: (pH = 7,0; DO ≥ 2,0 mg/L; RS = 20 days e qH = 31,2 and 20,4 hours), The last part was consisted of using respirometry evaluation toxicity effects of selected compounds over oxygen uptake rate to adaptated and non adaptated biomass in the presence of inhibitory compounds. The adaptated sludge showed greater degration capacity, with lower sensibility to toxic effects. The respirometry has proved to be very practical, as the techiniques used were simple and rapid, such as: Chemical Oxygen Demand (COD), Dissolved Oxygen (DO), and Volatile Suspended Solids (VSS). Using the latter it is possible to perform sludge selection to beggingthe process; thus allowing its use for aerobic treatment system`s behacior prediction

Oxidação úmida de fenóis com catalisadores de ferro suportado em argilominerais em reator de leito de lama (slurry)

The wet oxidation of organic compounds with CO2 and H2O has been demonstrated to be an efficient technique for effluent treatment. This work focuses on the synthesis, characterization and catalytic performance of Fe-MnO2/CeO2, K-MnO2/CeO2/ palygorskite and Fe/ palygorskite toward the wet oxidative degradation of phenol. The experiments were conducted in a sludge bed reactor with controlled temperature, pressure and stirring speed and sampling of the liquid phase. Experiments were performed on the following operating conditions: temperature 130 ° C, pressure 20.4 atm, catalyst mass concentration of 5 g / L initial concentration of phenol and 0.5 g / L. The catalytic tests were performed in a slurry agitated reactor provided with temperature, pressure and agitation control and reactor liquid sampling. The influences of iron loaded on the support (0.3; 7 and 10%, m/m) and the initial pH of the reactant medium (3.1; 6.8; 8.7) were studied. The iron dispersion on the palygorskite, the phase purity and the elemental composition of the catalyst were evaluated by X-Ray Difraction (XRD), Scanning Electron Microscopy (SEM) and X-Ray Flourescence (XRF). The use of palygorskite as support to increase the surface area was confirmed by the B.E.T. surface results. The phenol degradation curves showed that the Fe3+ over palygorskite when compared with the other materials tested has the best performance toward the (Total Organic carbonic) TOC conversion. The decrease in alkalinity of the reaction medium also favors the conversion of TOC. The maximum conversion obtained from the TOC with the catalyst 3% Fe / palygorskite was around 95% for a reaction time of 60 minutes, while reducing the formation of acids, especially acetic acid. With products obtained from wet oxidation of phenol, hydroquinone, p-benzoquinone, catechol and oxalic acid, identified and quantified by High Performance Liquid Chromatography was possible to propose a reaction mechanism of the process where the phenol is transformed into the homogeneous and heterogeneous phase in the other by applying a kinetic model, Langmuir-Hinshelwood type, with evaluation of kinetic constants of different reactions involved.

Desenvolvimento de um sistema foto-oxidativo visando aplicação no tratamento de águas produzidas em campos de petróleo

Increasing concern with the environment, in addition to strict laws, has induced the industries to find altenatives to the treatment of their wastes. Actually, the oil industry has sought solutions to overcome a big environmental problem, i.e., oil field produced water being discharged to the sea. These effluents have organic compounds dissolved, such as polycyclic aromatic hydrocarbons, phenols, benzene, toluene, ethylbenzene and xylenes (BTEX). These compounds are difficult to be removed and have high toxicity. The advanced oxidation processes - AOP are effective to degradation of these organic compounds, because they generate hydroxyl radicals with high potential of oxidation. This work includes the reactor photochemical development applied in the photodegradation treatment (by photo-Fenton process) of wastewaters containing organic compounds dissolved, aiming at treatment and recovery the oil field produced water. The studied reactor allowed the evaluation of two ultraviolet radiation sources that is the main factor to describe the feasibility of the photo¬Fenton treatment, i.e., sun and black light fluorescent lamps, and other relevant variables the process: concentration of reagents, irradiated area and also various reactor configurations to maximize the use of radiation. The organic matter degradation was verified with samples collected during the experimental and analyzed with a total organic carbon analyzer (TOC), which expressed the results in terms of mgC/L. The solar radiation was more effective than radiation from the lamps. it's an important factor for the operation costs cutting. Preliminary experiments applied to oil field produced water treatment have showed satisfactory results, reducing up to 76 % of organic matter

Desenvolvimento de um sistema foto-oxidativo visando aplicação no tratamento de águas produzidas em campos de petróleo

Increasing concern with the environment, in addition to strict laws, has induced the industries to find alternatives to the treatment of their wastes. Actually, the oil industry has sought solutions to overcome a big environmental problem, i.e., oil field produced water being discharged to the sea. These effluents have organic compounds dissolved, such as polycyclic aromatic hydrocarbons, phenols, benzene, toluene, ethylbenzene and xylenes (BTEX). These compounds are difficult to be removed and have high toxicity. The advanced oxidation processes - AOP are effective to degradation of these organic compounds, because they generate hydroxyl radicals with high potential of oxidation. This work includes the reactor photochemical development applied in the photodegradation treatment (by photo-Fenton process) of wastewaters containing organic compounds dissolved, aiming at treatment and recovery the oil field produced water. The studied reactor allowed the evaluation of two ultraviolet radiation sources that is the main factor to describe the feasibility of the photo- Fenton treatment, i.e., sun and black light fluorescent lamps, and other relevant variables the process: concentration of reagents, irradiated area and also various reactor configurations to maximize the use of radiation. The organic matter degradation was verified with samples collected during the experimental and analyzed with a total organic carbon analyzer (TOC), which expressed the results in terms of mgC/L. The solar radiation was more effective than radiation from the lamps. It's an important factor for the operation costs cutting. Preliminary experiments applied to oil field produced water treatment have showed satisfactory results, reducing up to 76 % of organic matter

Novas alternativas de remoção de enxofre do óleo diesel utilizando tensoativos e microemulsões

The diesel combustion form sulfur oxides that can be discharged into the atmosphere as particulates and primary pollutants, SO2and SO3, causing great damage to the environment and to human health. These products can be transformed into acids in the combustion chamber, causing damage to the engines. The worldwide concern with a clean and healthy environment has led to more restrictive laws and regulations regulating the emission levels of pollutants in the air, establishing sulfur levels increasingly low on fuels. The conventional methods for sulfur removal from diesel are expensive and do not produce a zero-level sulfur fuel. This work aims to develop new methods of removing sulfur from commercial diesel using surfactants and microemulsion systems. Its main purpose is to create new technologies and add economic viability to the process. First, a preliminary study using as extracting agent a Winsor I microemulsion system with dodecyl ammonium chloride (DDACl) and nonyl phenol ethoxylated (RNX95) as surfactant was performed to choose the surfactant. The RNX95 was chosen to be used as surfactant in microemulsioned systems for adsorbent surface modification and as an extracting agent in liquid-liquid extraction. Vermiculite was evaluated as adsorbent. The microemulsion systems applied for vermiculite surface modification were composed by RNX95 (surfactant), n-butanol (cosurfactant), n-hexane (oil phase), and different aqueous phases, including: distilled water (aqueous phase),20ppm CaCl2solution, and 1500ppm CaCl2solution. Batch and column adsorption tests were carried out to estimate the ability of vermiculite to adsorb sulfur from diesel. It was used in the experiments a commercial diesel fuel with 1,233ppm initial sulfur concentration. The batch experiments were performed according to a factorial design (23). Two experimental sets were accomplished: the first one applying 1:2 vermiculite to diesel ratio and the second one using 1:5 vermiculite to diesel ratio. It was evaluated the effects of temperature (25°C and 60°C), concentration of CaCl2in the aqueous phase (20ppm and 1500ppm), and vermiculite granule size (65 and 100 mesh). The experimental response was the ability of vermiculite to adsorb sulfur. The best results for both 1:5 and 1:2 ratios were obtained using 60°C, 1500ppm CaCl2solution, and 65 mesh. The best adsorption capacities for 1:5 ratio and for 1:2 ratio were 4.24 mg sulfur/g adsorbent and 2.87 mg sulfur/g adsorbent, respectively. It was verified that the most significant factor was the concentration of the CaCl2 solution. Liquid-liquid extraction experiments were performed in two and six steps using the same surfactant to diesel ratio. It was obtained 46.8% sulfur removal in two-step experiment and 73.15% in six-step one. An alternative study, for comparison purposes, was made using bentonite and diatomite asadsorbents. The batch experiments were done using microemulsion systems with the same aqueous phases evaluated in vermiculite study and also 20ppm and 1500 ppm BaCl2 solutions. For bentonite, the best adsorption capacity was 7.53mg sulfur/g adsorbent with distilled water as aqueous phase of the microemulsion system and for diatomite the best result was 17.04 mg sulfur/g adsorbent using a 20ppm CaCl2solution. The accomplishment of this study allowed us to conclude that, among the alternatives tested, the adsorption process using adsorbents modified by microemulsion systems was considered the best process for sulfur removal from diesel fuel. The optimization and scale upof the process constitutes a viable alternative to achieve the needs of the market

Determinação de Dados de Equilíbrio Líquido-Vapor para Sistemas Hidrocarbonetos e Desenvolvimento de uma Nova Célula Dinâmica

In the present work are established initially the fundamental relationships of thermodynamics that govern the equilibrium between phases, the models used for the description of the behavior non ideal of the liquid and vapor phases in conditions of low pressures. This work seeks the determination of vapor-liquid equilibrium (VLE) data for a series of multicomponents mixtures of saturated aliphatic hydrocarbons, prepared synthetically starting from substances with analytical degree and the development of a new dynamic cell with circulation of the vapor phase. The apparatus and experimental procedures developed are described and applied for the determination of VLE data. VLE isobarics data were obtained through a Fischer's ebulliometer of circulation of both phases, for the systems pentane + dodecane, heptane + dodecane and decane + dodecane. Using the two new dynamic cells especially projected, of easy operation and low cost, with circulation of the vapor phase, data for the systems heptane + decane + dodecane, acetone + water, tween 20 + dodecane, phenol + water and distillation curves of a gasoline without addictive were measured. Compositions of the equilibrium phases were found by densimetry, chromatography, and total organic carbon analyzer. Calibration curves of density versus composition were prepared from synthetic mixtures and the behavior excess volumes were evaluated. The VLE data obtained experimentally for the hydrocarbon and aqueous systems were submitted to the test of thermodynamic consistency, as well as the obtained from the literature data for another binary systems, mainly in the bank DDB (Dortmund Data Bank), where the Gibbs-Duhem equation is used obtaining a satisfactory data base. The results of the thermodynamic consistency tests for the binary and ternary systems were evaluated in terms of deviations for applications such as model development. Later, those groups of data (tested and approved) were used in the KijPoly program for the determination of the binary kij parameters of the cubic equations of state original Peng-Robinson and with the expanded alpha function. These obtained parameters can be applied for simulation of the reservoirs petroleum conditions and of the several distillation processes found in the petrochemistry industry, through simulators. The two designed dynamic cells used equipments of national technology for the determination Humberto Neves Maia de Oliveira Tese de Doutorado PPGEQ/PRH-ANP 14/UFRN of VLE data were well succeed, demonstrating efficiency and low cost. Multicomponents systems, mixtures of components of different molecular weights and also diluted solutions may be studied in these developed VLE cells

Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR)

Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). de acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.