980 resultados para X-ray double crystal diffraction
Resumo:
The structure of the 1-alkyl-3-methylimidazolium salts of the dinuclear mu(4)-(O,O,O',O'-ethane-1,2-dioato)-bis[bis(nitrato-O,O)dioxouranate(VI)] anion have been investigated using single crystal X-ray crystallography. In addition, EXAFS and electrochemical studies have been performed on the [C(4)mim](+) salt which is formed following the oxidative dissolution of uranium(IV) oxide in [C(4)mim][NO3]. EXAFS analysis of the solution following UO2 dissolution indicates a mixture of uranyl nitrate and mu(4)-(O,O,O',O'-ethane-1,2-dioato)-bis[bis(nitrato-O,O)dioxouranate(VI)] anions are formed.
Resumo:
Thermal analysis, powder diffraction, and Raman scattering as a function of the temperature were carried out on K2BeF4. Moreover, the crystal structure was determined at 293 K from powder diffraction. The compound shows a transition from Pna21 to Pnam space group at 921 K with a transition enthalpy of 5 kJ/mol. The transition is assumed to be first order because the compound shows metastability. Structurally and spectroscopically the transition is similar to those observed in (NH4)2SO4, which suggests that the low-temperature phase is ferroelectric. In order to confirm it, the spontaneous polarization has been computed using an ionic model.
Resumo:
Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.
Resumo:
In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.
Resumo:
In this paper, we give an overview of our studies by static and time-resolved X-ray diffraction of inverse cubic phases and phase transitions in lipids. In 1, we briefly discuss the lyotropic phase behaviour of lipids, focusing attention on non-lamellar structures, and their geometric/topological relationship to fusion processes in lipid membranes. Possible pathways for transitions between different cubic phases are also outlined. In 2, we discuss the effects of hydrostatic pressure on lipid membranes and lipid phase transitions, and describe how the parameters required to predict the pressure dependence of lipid phase transition temperatures can be conveniently measured. We review some earlier results of inverse bicontinuous cubic phases from our laboratory, showing effects such as pressure-induced formation and swelling. In 3, we describe the technique of pressure-jump synchrotron X-ray diffraction. We present results that have been obtained from the lipid system 1:2 dilauroylphosphatidylcholine/lauric acid for cubic-inverse hexagonal, cubic-cubic and lamellar-cubic transitions. The rate of transition was found to increase with the amplitude of the pressure-jump and with increasing temperature. Evidence for intermediate structures occurring transiently during the transitions was also obtained. In 4, we describe an IDL-based 'AXCESS' software package being developed in our laboratory to permit batch processing and analysis of the large X-ray datasets produced by pressure-jump synchrotron experiments. In 5, we present some recent results on the fluid lamellar-Pn3m cubic phase transition of the single-chain lipid 1-monoelaidin, which we have studied both by pressure-jump and temperature-jump X-ray diffraction. Finally, in 6, we give a few indicators of future directions of this research. We anticipate that the most useful technical advance will be the development of pressure-jump apparatus on the microsecond time-scale, which will involve the use of a stack of piezoelectric pressure actuators. The pressure-jump technique is not restricted to lipid phase transitions, but can be used to study a wide range of soft matter transitions, ranging from protein unfolding and DNA unwinding and transitions, to phase transitions in thermotropic liquid crystals, surfactants and block copolymers.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Reaction of with one or two equivalents of LiPPh2 afforded the new phosphanidometal(III) complexes . Reaction of 2 with LiC≡CSiMe3 led to the diamagnetic zirconium(III) alkynyl derivative [{Zr(C5H5)(μ−C≡CSiMe3)}2(μ−η5−C5H4−η5−C5H4], 7. Alkylation of 6 with LiCH2CMe2Ph gave [{Zr(η5−C5H5)(CH2CMe2Ph)2}2{μ−(η5−C5H4)}], 8. A detailed NMR study of complexes 3 and 4 allowed the observation of the spectral behaviour of the eight different fulvalene protons through their coupling to the 31P nucleus. The fluxional behaviour of complex 7 was studied by dynamic DNMR, and kinetic parameters for the σ-π-conversion of the alkynyl ligand were determined. The molecular structures of complexes 3 and 7 were determined by X-ray diffraction methods.
Resumo:
[Ru2(μ-O2CCH3)4Cl] reacts readily with aqueous Ag2SO4 (2: 1 molar ratio) to give the sulphate salt [Ru2(μ-O2CCH3)4(H2O)2]2(SO4) (1). Addition of NaBPh4 to an aqueous solution of 1 produces the ether-soluble tetraphenylborate salt [Ru2(μ-O2CCH3)4(H2O)2][BPh4] (2). A methanolic solution of 1 reacts with Ba(C6H5CCCO2)2 · H2O to give the tetraacetatemonophenylpropynoate complex [Ru2(μ-O2CCH3)4(O2CCCC6H5)] · H2O (3). The reaction of an ethanolic suspension of [Ru2(μ-O2CC6H5)4Cl] with Ag2SO4 and H2SO4 (2 : 1 : 1 molar ratio) leads to the tetra-μ-benzoatodiruthenium(II,III) double complex salt [Ru2(μ-O2CC6H5)4(C2H5OH)2][Ru2(μ-O2CC6H5)4(HSO4)2] (4). Complex 4 is also obtained by reacting an ethanolic solution of 1 with an excess of benzoic acid in the presence of H2SO4. The X-ray crystal structure of 4 shows it to consist of [Ru2(μ-O2CC6H5)4(C2H5OH)2]+ and [Ru2(μ-O2CC6H5)4(HSO4)2]− ions, which are linked together by hydrogen bonds into an infinite polymeric chain. The RuRu distances in the cation and anion are very similar [2.265(2) and 2.272(2) Å, respectively]. Spectroscopic, magnetic, conductivity and cyclic voltammetry data are given for the complexes.
Resumo:
The reaction of the fulvalene titanium(III) hydride [{Ti(η5-C5H5)(μ-H)}2(μ-η5-η5-C10H8)] (1) with chlorine leads to [{Ti(η5-C5H5)(μ-Cl)}2(μ-η5-η5-C10H8)] (3) and [{Ti(η5-C5H5)Cl2}2(μ-η5-η5-C10H8)] (4). The reaction of 3 with azobenzene, in wet toluene, gives [{Ti(η5-C5H5)Cl}2(μ-O)(μ-η5-η5-C10H8)] (5) and 1,2-diphenyl hydrazine. The alkylation of 4 and the analogous zirconium complex [{Zr(η5-C5H55)Cl2}2(μ-η5-η5-C10H8)] (2) with LiCH2SiMe3 or LiCH3 permits isolation of the tetraalkyl derivatives [{M(η5-C5H5)(CH2SiMe3)2}2(μ-η5-η5-C10H8)] (M Ti (6); Zr (8)) and [{Ti(η5-C5H5)(CH3)2}2(μ-η5-η5C10H8)] (7). All the new fulvalene compounds were characterized by IR, and 1H and 13C NMR spectroscope, and mass spectra and 5 by X-ray diffraction. The structure of 5 is very similar to that of the comparable TiIV compound [{Ti(η5-C5H5)2Cl}2(μ-O)] except for the smaller TiOTi angle (159.4° against 173.81°) and a significant deviation from linearity.
Resumo:
Treatment of of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) in methanol with aqueous NH(4)VO(3) solution in perchloric acid medium affords the mononuclear oxovanadium(V) complex [VOL(1)(MeOH)]-ClO(4) (1) as deep blue solid while the treatment of same solution of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) with aqueous solution of VOSO(4) leads to the formation of di-(mu-oxo) bridged vanadium(V) complex [VO(2)L(2)](2) (2) as green solid where HL(2) = (R,R)-N-salicylidene cyclohexane 1,2-diamine. The ligand HL(2) is generated in situ by the hydrolysis of one of the imine bonds of HL(1) ligand during the course of formation of complex [VO(2)L(2)](2) (2). Both the compounds have been characterized by single crystal X-ray diffraction as well as spectroscopic methods. Compounds 1 and 2 are to act as catalyst for the catalytic bromide oxidation and C-H bond oxidation in presence of hydrogen peroxide. The representative substrates 2,4-dimethoxy benzoic acid and para-hydroxy benzoic acids are brominated in presence of H(2)O(2) and KBr in acid medium using the above compounds as catalyst. The complexes are also used as catalyst for C-H bond activation of the representative hydrocarbons toluene, ethylbenzene and cyclohexane where hydrogen peroxide acts as terminal oxidant. The yield percentage and turnover number are also quite good for the above catalytic reaction. The oxidized products of hydrocarbons have been characterized by GC Analysis while the brominated products have been characterized by (1)H NMR spectroscopic studies.
Resumo:
X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.
Resumo:
A robust, direct, rapid and non-destructive X-ray diffraction crystallography method to detect the polyprenylated benzophenones 7-epi-clusianone (1) and guttiferone A (2) in extracts from Garcinia brasiliensis is presented. Powder samples of benzophenones 1 and 2, dried hexane extracts from G. brasiliensis seeds and fruit`s pericarp, and the dried ethanolic extract from G. brasiliensis seeds were unambiguously characterized by powder X-ray diffractometry. The calculated X-ray diffraction peaks from crystal structures of analytes 1 and 2, previously determined by single-crystal X-ray diffraction technique, were overlaid to those of the experimental powder diffractograms, providing a practical identification of these compounds in the analyzed material and confirming the pure contents of the powder samples. Using the X-ray diffraction crystallography method, the studied polyprenylated benzophenones were selectively and simultaneously detected in the extracts which were mounted directly on sample holder. In addition, reference materials of the analytes were not required for analyses since the crystal structures of the compounds are known. High performance liquid chromatography analyses also were comparatively carried out to quantify the analytes in the same plant extracts showing to be in agreement with X-ray diffraction crystallography method. (C) 2010 Elsevier B.V. All rights reserved.
Resumo:
The conformational features of three 2-sulphur-substituted cyclohexanone derivatives, which differ in the number of sulphur-bound oxygen atoms, i.e. zero (I), one (II) and two (III), were investigated by single crystal X-ray crystallography and geometry optimized structures determined using Hartree-Fock method. In each of (I)-(III) an intramolecular S center dot center dot center dot O(carbonyl) interaction is found with the magnitude correlated with the oxidation state of the sulphur atom, i.e. 2.838(3) angstrom in (I) to 2.924(2) angstrom in (II) to 3.0973(18) angstrom in (III). There is an inverse relationship between the strength of this interaction and the magnitude of the carbonyl bond. The supramolecular aggregation patterns are primarily determined by C-H center dot center dot center dot O contacts and are similarly influenced by the number of oxygen atoms in the molecular structures. Thus, a supramolecular chain is found in the crystal structure of (I). With an additional oxygen atom available to participate in C-H center dot center dot center dot O interactions, as in (II), a two-dimensional array is found. Finally, a three-dimensional network is found for (III). Despite there being differences in conformations between the experimental structures and those calculated in the gas-phase, the S center dot center dot center dot O interactions persist. The presence of intermolecular C-H center dot center dot center dot O interactions involving the cyclohexanone-carbonyl group in the solid-state, disrupts the stabilising intramolecular C-H center dot center dot center dot O interaction in the energetically-favoured conformation. (I): C(12)H(13)NO(3)S, triclinic space group P (1) over bar with a = 5.392(3) angstrom b = 10.731(6) angstrom, c = 11.075(6) angstrom, alpha = 113.424(4)degrees, beta = 94.167(9)degrees, gamma = 98.444(6)degrees, V = 575.5(6) angstrom(3), Z = 2, R(1) = 0.052; (II): C(12)H(13)NO(4)S, monoclinic P2(1)/n, a = 7.3506(15) angstrom, b = 6.7814(14) angstrom, c = 23.479(5) angstrom, beta = 92.94(3)degrees, V = 1168.8(4) angstrom(3), Z = 4, R(1) = 0.046; (III): C(12)H(13)NO(5)S, monoclinic P2(1)/c, a = 5.5491(11) angstrom, b = 24.146(3) angstrom, c = 11.124(3) angstrom, beta = 114.590(10)degrees, V = 1355.3(5) angstrom(3), Z = 4, R(1) = 0.051.
Resumo:
The synthesis and characterization of some pyrazoline compounds of 1,3-diketones with hydrazine derivatives, namely, 1-(S-benzyldithiocarbazate)-3-methyl-5-phenyl-5-hydroxypyrazoline (1); 1-(2-thiophenecarboxylic)-3-methyl-5-phenyl-5-hydroxypyrazoline (2); 1-(2-thiophenecarboxylic)-3,5-dimethyl-5-hydroxypyrazoline (3); 1-(S-benzyldithiocarbazato)-3-methyl-5-phenylpyrazole (4); 1-(2-thiophenecarboxylic)-3-methyl-5-phenylpyrazole (5) and 1-(S-benzyldithiocarbazate)-3,5-dimethylpyrazole (6) are reported. Studies by IR, ((1)H, (13)C)-NMR spectroscopies and single crystal X-ray diffraction revealed that compounds (1)(,) (2) and (3) are formed as pyrazoline, whereas (4) and (5) are formed as pyrazole derivatives only under acidic conditions. Compound (1) crystallizes in orthorhombic P2(1)2(1)2(1), a = 6.38960(10) angstrom, b = 12.9176(3) angstrom, c = 21.2552(5) angstrom, (2) crystallizes in monoclinic, P2(1)/n, a = 11.3617(2) angstrom, b = 8.4988(2) angstrom, c = 92.8900(10)angstrom and beta = 92.8900(5)degrees, (3) crystallizes in monoclinic, C2/c, a = 15.9500(5) angstrom, b = 9.3766(3) angstrom, c = 16.6910(5)angstrom and beta = 113.825(2)degrees, (4) crystallizes in monoclinic, P2(1)/c, a = 15.228(4) angstrom, b = 5.5714(13) angstrom, c = 19.956(5)angstrom and beta = 91.575(7)degrees and (6) crystallizes in orthorhombic, P2(1)2(1)2(1), a = 5.3920(2) angstrom, b = 11.2074(5) angstrom, c = 21.885(1)angstrom . The (3) derivative represents the first pyrazoline compound prepared from 2,4-pentanedione and characterized crystallographically.
Resumo:
ADP-glucose pyrophosphorylase is the key regulatory enzyme in the biosynthesis of starch in plants and glycogen in bacteria. The enzyme from potato tuber is comprised of a regulatory subunit and a catalytic subunit and is present as a heterotetramer (alpha(2)beta(2)) the catalytic subunit from potato tuber (50 kDa) was crystallized in four different forms, two of which are suitable for structural studies. A tetragonal crystal form obtained in the presence of the substrate analog Cr-ATP diffracted to 2.2 Angstrom and belongs to space group P4(1) (or its enantiomorph), with unit-cell parameters a = b = 110.57, c = 190.14 Angstrom. A second crystal form obtained diffracted to 2.8 Angstrom and belongs to space group PZ, with unit-eel parameters a = 80.06, b = 138.84, c = 92.20 Angstrom, beta = 112.40 degrees. As this protein displays no significant homology to any currently known protein structure, a search for heavy-atom derivatives has been initiated.