Adiponectin and heme oxygenase-1 suppress TLR4/MyD88-independent signaling in rat Kupffer cells and in mice after chronic ethanol exposure.

Alcoholic liver disease is mediated via activation of TLR4 signaling; MyD88-dependent and -independent signals are important contributors to injury in mouse models. Adiponectin, an anti-inflammatory adipokine, suppresses TLR4/MyD88-dependent responses via induction of heme oxygenase-1 (HO-1). Here we investigated the interactions between chronic ethanol, adiponectin, and HO-1 in regulation of TLR4/MyD88-independent signaling in macrophages and an in vivo mouse model. After chronic ethanol feeding, LPS-stimulated expression of IFN-β and CXCL10 mRNA was increased in primary cultures of Kupffer cells compared with pair-fed control mice. Treatment of Kupffer cells with globular adiponectin (gAcrp) normalized this response. LPS-stimulated IFN-β/CXCL10 mRNA and CXCL10 protein was also reduced in RAW 264.7 macrophages treated with gAcrp or full-length adiponectin. gAcrp and full-length adiponectin acted via adiponectin receptors 1 and 2, respectively. gAcrp decreased TLR4 expression in both Kupffer cells and RAW 264.7 macrophages. Small interfering RNA knockdown of HO-1 or inhibition of HO-1 activity with zinc protoporphyrin blocked these effects of gAcrp. C57BL/6 mice were exposed to chronic ethanol feeding, with or without treatment with cobalt protoporphyrin, to induce HO-1. After chronic ethanol feeding, mice were sensitized to in vivo challenge with LPS, expressing increased IFN-β/CXCL10 mRNA and CXCL10 protein in liver compared with control mice. Pretreatment with cobalt protoporphyrin 24 h before LPS challenge normalized this effect of ethanol. Adiponectin and induction of HO-1 potently suppressed TLR4-dependent/MyD88-independent cytokine expression in primary Kupffer cells from rats and in mouse liver after chronic ethanol exposure. These data suggest that induction of HO-1 may be a useful therapeutic strategy in alcoholic liver disease.

Ophtalmologie. Thérapies anti-vasoprolifératives

The most important recent advance in the treatment of neovascular age-related macular degeneration (AMD) is the development of antivascular endothelial growth factor (anti-VEGF) therapeutic agents that preserve and improve visual acuity by arresting choroidal neovascular growth and reducing vascular permeability. Two anti-VEGF agents, ranibizumab and pegaptanib sodium, are currently approved by Swissmedic for the treatment of neovascular AMD. A third anti-VEGF agent, bevacizumab, is currently used as an off label treatment option for exsudative AMD. Other anti-VEGF agent strategies that have shown efficacy include among others, small interfering RNA agents to silence the VEGF gene and receptor and the fusion protein VEGF trap. Anti-VEGF therapies have been used successfully in the clinic, encouraging their use in the treatment of other neovascular and exudative eye diseases.

Hepatocyte nuclear factor-4 alpha regulates the human apolipoprotein AV gene: Identification of a novel response element and involvement in the control by peroxisome proliferator-activated receptor-gamma coactivator-1 alpha, AMP-activated protein kinase, and mitogen-activated protein kinase pathway

The recently discovered apolipoprotein AV (apoAV) gene has been reported to be a key player in modulating plasma triglyceride levels. Here we identify the hepatocyte nuclear factor-4 (HNF-4 ) as a novel regulator of human apoAV gene. Inhibition of HNF-4 expression by small interfering RNA resulted in down-regulation of apoAV. Deletion, mutagenesis, and binding assays revealed that HNF-4 directly regulates human apoAV promoter through DR1 [a direct repeat separated by one nucleotide (nt)], and via a novel element for HNF-4 consisting of an inverted repeat separated by 8 nt (IR8). In addition, we show that the coactivator peroxisome proliferator-activated receptor- coactivator-1 was capable of stimulating the HNF-4 -dependent transactivation of apoAV promoter. Furthermore, analyses in human hepatic cells demonstrated that AMP-activated protein kinase (AMPK) and the MAPK signaling pathway regulate human apoAV expression and suggested that this regulation may be mediated, at least in part, by changes in HNF-4 . Intriguingly, EMSAs and mice with a liver-specific disruption of the HNF-4 gene revealed a species-distinct regulation of apoAV by HNF-4 , which resembles that of a subset of HNF-4 target genes. Taken together, our data provide new insights into the binding properties and the modulation of HNF-4 and underscore the role of HNF-4 in regulating triglyceride metabolism.

Gene transfer engineering for astrocyte-specific silencing in the CNS.

Cell-type-specific gene silencing is critical to understand cell functions in normal and pathological conditions, in particular in the brain where strong cellular heterogeneity exists. Molecular engineering of lentiviral vectors has been widely used to express genes of interest specifically in neurons or astrocytes. However, we show that these strategies are not suitable for astrocyte-specific gene silencing due to the processing of small hairpin RNA (shRNA) in a cell. Here we develop an indirect method based on a tetracycline-regulated system to fully restrict shRNA expression to astrocytes. The combination of Mokola-G envelope pseudotyping, glutamine synthetase promoter and two distinct microRNA target sequences provides a powerful tool for efficient and cell-type-specific gene silencing in the central nervous system. We anticipate our vector will be a potent and versatile system to improve the targeting of cell populations for fundamental as well as therapeutic applications.

Comprehensive Genomic Characterization of Long Non-coding RNAs across Human Cancers.

The discovery of long non-coding RNA (lncRNA) has dramatically altered our understanding of cancer. Here, we describe a comprehensive analysis of lncRNA alterations at transcriptional, genomic, and epigenetic levels in 5,037 human tumor specimens across 13 cancer types from The Cancer Genome Atlas. Our results suggest that the expression and dysregulation of lncRNAs are highly cancer type specific compared with protein-coding genes. Using the integrative data generated by this analysis, we present a clinically guided small interfering RNA screening strategy and a co-expression analysis approach to identify cancer driver lncRNAs and predict their functions. This provides a resource for investigating lncRNAs in cancer and lays the groundwork for the development of new diagnostics and treatments.

CCN2/CTGF silencing blocks cell aggregation in embryonal carcinoma P19 cell

Connective tissue growth factor (CCN2/CTGF) is a matricellular-secreted protein involved in extracellular matrix remodeling. The P19 cell line is an embryonic carcinoma line widely used as a cellular model for differentiation and migration studies. In the present study, we employed an exogenous source of CCN2 and small interference RNA to address the role of CCN2 in the P19 cell aggregation phenomenon. Our data showed that increasing CCN2 protein concentrations from 0.1 to 20 nM decreased the number of cell clusters and dramatically increased cluster size without changing proliferation or cell survival, suggesting that CCN2 induced aggregation. In addition, CCN2 specific silencing inhibited typical P19 cell aggregation, which could be partially rescued by 20 nM CCN2. The present study demonstrates that CCN2 is a key molecule for cell aggregation of embryonic P19 cells.

Inhibition of cytohesin-1 by siRNA leads to reduced IGFR signaling in prostate cancer

To explore how cytohesin-1 (CYTH-1) small interfering RNA (siRNA) influences the insulin-like growth factor receptor (IGFR)-associated signal transduction in prostate cancer, we transfected human prostate cancer PC-3 cell lines with liposome-encapsulatedCYTH-1 siRNA in serum-free medium and exposed the cells to 100 nM IGF-1. The mRNA and protein levels of the signal molecules involved in the IGFR signaling pathways were determined by real-time PCR and detected by Western blotting. The relative mRNA levels of CYTH-1, c-Myc, cyclinD1 and IGF-1R (CYTH-1 siRNA group vs scrambled siRNA group) were 0.26 vs 0.97, 0.34 vs 1.06, 0.10 vs 0.95, and 0.27 vs 0.41 (P < 0.05 for all), respectively. The relative protein levels of CYTH-1, pIGF-1R, pIRS1, pAkt1, pErk1, c-Myc, and cyclinD1 (CYTH-1 siRNA group vsscrambled siRNA group) were 0.10 vs 1.00 (30 min), 0.10 vs 0.98 (30 min), 0.04 vs 0.50 (30 min), 0.10 vs 1.00 (30 min), 0.10 vs 1.00 (30 min), 0.13 vs 0.85 (5 h), and 0.08 vs 0.80 (7 h), respectively. The tyrosine kinase activity of IGF-1R was associated with CYTH-1. The proliferative activity of PC-3 cells transfected with CYTH-1 siRNA was significantly lower than that of cells transfected with scrambled siRNA at 48 h (40.5 vs87.6%, P < 0.05) and at 72 h (34.5 vs 93.5%, P < 0.05). In conclusion, the interference of siRNA with cytohesin-1 leads to reduced IGFR signaling in prostate cancer; therefore, CYTH-1 might serve as a new molecular target for the treatment of prostate cancer.

REGγ is a strong candidate for the regulation of cell cycle, proliferation and the invasion by poorly differentiated thyroid carcinoma cells

REGγ is a proteasome activator that facilitates the degradation of small peptides. Abnormally high expression of REGγ has been observed in thyroid carcinomas. The purpose of the present study was to explore the role of REGγ in poorly differentiated thyroid carcinoma (PDTC). For this purpose, small interfering RNA (siRNA) was introduced to down-regulate the level of REGγ in the PDTC cell line SW579. Down-regulation of REGγ at the mRNA and protein levels was confirmed by RT-PCR and Western blot analyses. FACS analysis revealed cell cycle arrest at the G1/S transition, the MTT assay showed inhibition of cell proliferation, and the Transwell assay showed restricted cell invasion. Furthermore, the expression of the p21 protein was increased, the expression of proliferating cell nuclear antigen (PCNA) protein decreased, and the expression of the p27 protein was unchanged as shown by Western blot analyses. REGγ plays a critical role in the cell cycle, proliferation and invasion of SW579 cells. The alteration of p21 and PCNA proteins related to the down-regulation of REGγ suggests that p21 and PCNA participate in the process of REGγ regulation of cell cycle progression and cell proliferation. Thus, targeting REGγ has a therapeutic potential in the management of PDTC patients.

Adenovirus-mediated siRNA targeting TNF-α and overexpression of bone morphogenetic protein-2 promotes early osteoblast differentiation on a cell model of Ti particle-induced inflammatory response in vitro

Wear particles are phagocytosed by macrophages and other inflammatory cells, resulting in cellular activation and release of proinflammatory factors, which cause periprosthetic osteolysis and subsequent aseptic loosening, the most common causes of total joint arthroplasty failure. During this pathological process, tumor necrosis factor-alpha (TNF-α) plays an important role in wear-particle-induced osteolysis. In this study, recombination adenovirus (Ad) vectors carrying both target genes [TNF-α small interfering RNA (TNF-α-siRNA) and bone morphogenetic protein 2 (BMP-2)] were synthesized and transfected into RAW264.7 macrophages and pro-osteoblastic MC3T3-E1 cells, respectively. The target gene BMP-2, expressed on pro-osteoblastic MC3T3-E1 cells and silenced by the TNF-α gene on cells, was treated with titanium (Ti) particles that were assessed by real-time PCR and Western blot. We showed that recombinant adenovirus (Ad-siTNFα-BMP-2) can induce osteoblast differentiation when treated with conditioned medium (CM) containing RAW264.7 macrophages challenged with a combination of Ti particles and Ad-siTNFα-BMP-2 (Ti-ad CM) assessed by alkaline phosphatase activity. The receptor activator of nuclear factor-κB ligand was downregulated in pro-osteoblastic MC3T3-E1 cells treated with Ti-ad CM in comparison with conditioned medium of RAW264.7 macrophages challenged with Ti particles (Ti CM). We suggest that Ad-siTNFα-BMP-2 induced osteoblast differentiation and inhibited osteoclastogenesis on a cell model of a Ti particle-induced inflammatory response, which may provide a novel approach for the treatment of periprosthetic osteolysis.

Downregulation of survivin by siRNA inhibits invasion and promotes apoptosis in neuroblastoma SH-SY5Y cells

Neuroblastoma is a solid tumor that occurs mainly in children. Malignant neuroblastomas have a poor prognosis because conventional chemotherapeutic agents are not very effective. Survivin, a member of the inhibitor of the apoptosis protein family, plays a significant role in cell division, inhibition of apoptosis, and promotion of cell proliferation and invasion. Previous studies found that survivin is highly expressed in some malignant neuroblastomas and is correlated with poor prognosis. The aim of this study was to investigate whether survivin could serve as a potential therapeutic target of human neuroblastoma. We employed RNA interference to reduce survivin expression in the human neuroblastoma SH-SY5Y cell line and analyzed the effect of RNA interference on cell proliferation and invasion in vitro and in vivo. RNA interference of survivin led to a significant decrease in invasiveness and proliferation and increased apoptosis in SH-SY5Y cells in vitro. RNA interference of survivin inhibited tumor growth in vivo by 68±13% (P=0.002) and increased the number of apoptotic cells by 9.8±1.2% (P=0.001) compared with negative small interfering RNA (siRNA) treatment controls. Moreover, RNA interference of survivin inhibited the formation of lung metastases by 92% (P=0.002) and reduced microvascular density by 60% (P=0.0003). Survivin siRNA resulted in significant downregulation of survivin mRNA and protein expression both in vitro and in vivo compared with negative siRNA treatment controls. RNA interference of survivin was found to be a potent inhibitor of SH-SY5Y tumor growth and metastasis formation. These results support further clinical development of RNA interference of survivin as a treatment of neuroblastoma and other cancer types.

A combination of STI571 and BCR-ABL1 siRNA with overexpressed p15INK4B induced enhanced proliferation inhibition and apoptosis in chronic myeloid leukemia

p15INK4B, a cyclin-dependent kinase inhibitor, has been recognized as a tumor suppressor. Loss of or methylation of the p15INK4B gene in chronic myeloid leukemia (CML) cells enhances myeloid progenitor formation from common myeloid progenitors. Therefore, we examined the effects of overexpressed p15INK4B on proliferation and apoptosis of CML cells. Overexpression of p15INK4B inhibited the growth of K562 cells by downregulation of cyclin-dependent kinase 4 (CDK4) and cyclin D1 expression. Overexpression of p15INK4B also induced apoptosis of K562 cells by upregulating Bax expression and downregulating Bcl-2 expression. Overexpression of p15INK4B together with STI571 (imatinib) or BCR-ABL1 small interfering RNA (siRNA) also enhanced growth inhibition and apoptosis induction of K562 cells. The enhanced effect was also mediated by reduction of cyclin D1 and CDK4 and regulation of Bax and Bcl-2. In conclusion, our study may provide new insights into the role of p15INK4B in CML and a potential therapeutic target for overcoming tyrosine kinase inhibitor resistance in CML.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Synthesis of Short Oligonucleotides on a Soluble Support by the Phosphoramidite Method

In the last decades, the chemical synthesis of short oligonucleotides has become an important aspect of study due to the discovery of new functions for nucleic acids such as antisense oligonucleotides (ASOs), aptamers, DNAzymes, microRNA (miRNA) and small interfering RNA (siRNA). The applications in modern therapies and fundamental medicine on the treatment of different cancer diseases, viral infections and genetic disorders has established the necessity to develop scalable methods for their cheaper and easier industrial manufacture. While small scale solid-phase oligonucleotide synthesis is the method of choice in the field, various challenges still remain associated with the production of short DNA and RNA-oligomers in very large quantities. On the other hand, solution phase synthesis of oligonucleotides offers a more predictable scaling-up of the synthesis and is amenable to standard industrial manufacture techniques. In the present thesis, various protocols for the synthesis of short DNA and RNA oligomers have been studied on a peracetylated and methylated β-cyclodextrin, and also on a pentaerythritol-derived support. On using the peracetylated and methylated β-cyclodextrin soluble supports, the coupling cycle was simplified by replacement of the typical 5′-O-(4,4′-dimethoxytrityl) protecting group with an acid-labile acetal-protected 5′-O-(1-methoxy-1-methylethyl) group, which upon acid-catalyzed methanolysis released easily removable volatile products. For this reason monomeric building blocks 5′-O-(1-methoxy-1-methylethyl) 3′-(2-cyano-ethyl-N,N-diisopropylphosphoramidite) were synthesized. Alternatively, on using the precipitative pentaerythritol support, novel 2´-O-(2-cyanoethyl)-5´-O-(1-methoxy-1-methylethyl) protected phosphoramidite building blocks for RNA synthesis have been prepared and their applicability by the synthesis of a pentamer was demonstrated. Similarly, a method for the preparation of short RNAs from commercially available 5´-O-(4,4´-dimethoxytrityl)-2´-O-(tert-butyldimethyl-silyl)ribonucleoside 3´-(2-cyanoethyl-N,N-diisopropylphosphoramidite) building blocks has been developed

Development of techniques for testing the effect of the E1 region on adenovirus integration /

Adenoviral vectors are currently the most widely used gene therapeutic vectors, but their inability to integrate into host chromosomal DNA shortened their transgene expression and limited their use in clinical trials. In this project, we initially planned to develop a technique to test the effect of the early region 1 (E1) on adenovirus integration by comparing the integration efficiencies between an E1-deleted adenoviral vector (SubE1) and an Elcontaining vector (SubE3). However, we did not harvest any SubE3 virus, even if we repeated the transfection and successfully rescued the SubE1 virus (2/4 transfections generated viruses) and positive control virus (6/6). The failure of rescuing SubE3 could be caused by the instability of the genomic plasmid pFG173, as it had frequent intemal deletions when we were purifying It. Therefore, we developed techniques to test the effect of E1 on homologous recombination (HR) since literature suggested that adenovirus integration is initiated by HR. We attempted to silence the E1 in 293 cells by transfecting E1A/B-specific small interfering RNA (siRNA). However, no silenced phenotype was observed, even if we varied the concentrations of E1A/B siRNA (from 30 nM to 270 nM) and checked the silencing effects at different time points (48, 72, 96 h). One possible explanation would be that the E1A/B siRNA sequences are not potent enough to Induce the silenced phenotype. For evaluating HR efficiencies, an HR assay system based on bacterial transfonmatJon was designed. We constmcted two plasmids ( designated as pUC19-dl1 and pUC19-dl2) containing different defective lacZa cassettes (forming white colonies after transformation) that can generate a functional lacZa cassette (forming blue colonies) through HR after transfecting into 293 cells. The HR efficiencies would be expressed as the percentages of the blue colonies among all the colonies. Unfortunately, after transfonnation of plasmid isolated from 293 cells, no colony was found, even at a transformation efficiency of 1.8x10^ colonies/pg pUC19, suggesting the sensitivity of this system was low. To enhance the sensitivity, PCR was used. We designed a set of primers that can only amplify the recombinant plasmid fomied through HR. Therefore, the HR efficiencies among different treatments can be evaluated by the amplification results, and this system could be used to test the effect of E1 region on adenovirus integration. In addition, to our knowledge there was no previous studies using PCR/ Realtime PCR to evaluate HR efficiency, so this system also provides a PCR-based method to carry out the HR assays.

Chemical synthesis of glycosylated oligoribonucleotides for siRNA development

In this study, an efficient methodology for the preparation of carbohydrate-RNA conjugates was established, which involved the use of 3,4~diethoxy-3-cyclobutene-l,2- dione (diethyl squarate) as the linking reagent. First, a glycan moiety containing an amino group reacted with diethyl squarate to form an activated glycan, which further reacted with an amino modified oligoribonucleotide to form a glycoconjugate under slightly basic conditions. The effect of glycosylation on the stability of RNA molecules was evaluated on two glycoconjugates, monomannosyl UlO-mer and dimannosyl UlO-mer. In the synthesis of aromatic fluorescent ribosides, perbenzylated ribofuranosyl pyrene and phenanthrene were synthesized from perbenzylated ribolactone. Deprotection of benzyl-protected ribofuranosyl phenanthrene and pyrene by boron tribromide gave ribofuranosyl phenanthrene and ribopyranosyl pyrene, respectively. UV/vis and fluorescent properties of the ribosides were characterized.