Mutagenicity of herpes simplex virus type 1 in a shuttle vector

The shuttle vector plasmid pZ189 was used to find the kinds of mutations that are induced by herpes simplex virus type-1 (HSV-1). In cells infected by HSV-1 the frequency of mutation in supF gene, the mutagenesis marker, was increased over background by from two- to seven-fold, reaching 0.14-0.45%. No increase was induced by infection by vaccinia virus under the same conditions. Mutagenesis was an early event, showing a four-fold increase in mutation frequency at only two hours after infection, and peaking at a seven-fold increase at four hours after infection. DNA sequencing and gel electrophoresis analysis were performed on 105 HSV-1 induced mutants and 65 spontaneous mutants and provided the following information: (1) A change in plasmid size was seen in 54% of HSV-1 related mutants, compared with only 37% of spontaneous mutants. (2) Among point mutations, the predominant type was G:C to A:T transition, which accounted for 51% of point mutations in mutants isolated from cells infected with HSV-1, and 32% of point mutations in spontaneous mutants. (3) Deletions of DNA were seen in HSV-1 related mutants at a frequency of 40%, compared with 29% in spontaneous mutants. The HSV-1 related deletions were about half the length of spontaneous mutants and three contained short filler sequences. (4) Fifteen (15%) of HSV-1 induced mutants revealed the altered restriction patterns on agarose gel electrophoresis analysis and were due either to rearrangements of plasmid DNA, and/or to insertion of sequences derived from chromosomal DNA (seven plasmids). No insertions of DNA from HSV-1 were detected. Among spontaneous mutants, only 5 (7.7%) were rearrangements and none had inserted chromosomal DNA. (5) DNA sequence analysis of seven plasmids with inserted chromosomal DNA revealed that four cases had repetitive DNA sequences integrated and the other three were unidentified sequences from the GenBank database. Three repetitive DNA included $\alpha$ satellite, Alu and KpnI family sequences. The other sequence was identified as tRNA-like component. The observed mutations have implications for the mechanism of malignant transformation of cells by HSV-1. ^

Metaphase and interphase fluorescence in situ hybridization mapping of the rice genome with bacterial artificial chromosomes.

Fluorescence in situ hybridization (FISH) is a powerful tool for physical mapping in human and other mammalian species. However, application of the FISH technique has been limited in plant species, especially for mapping single- or low-copy DNA sequences, due to inconsistent signal production in plant chromosome preparations. Here we demonstrate that bacterial artificial chromosome (BAC) clones can be mapped readily on rice (Oryza sativa L.) chromosomes by FISH. Repetitive DNA sequences in BAC clones can be suppressed efficiently by using rice genomic DNA as a competitor in the hybridization mixture. BAC clones as small as 40 kb were successfully mapped. To demonstrate the application of the FISH technique in physical mapping of plant genomes, both anonymous BAC clones and clones closely linked to a rice bacterial blight-resistance locus, Xa21, were chosen for analysis. The physical location of Xa21 and the relationships among the linked clones were established, thus demonstrating the utility of FISH in plant genome analysis.

Repeated evolution of heat responsiveness among Brassicaceae COPIA transposable elements

Eukaryotic genomes contain repetitive DNA sequences. This includes simple repeats and more complex transposable elements (TEs). Many TEs reach high copy numbers in the host genome, owing to their amplification abilities by specific mechanisms. There is growing evidence that TEs contribute to gene transcriptional regulation. However, excess of TE activity may lead to reduced genome stability. Therefore, TEs are suppressed by the transcriptional gene silencing machinery via specific chromatin modifications. In contrary, effectiveness of the epigenetic silencing mechanisms imposes risk for TE survival in the host genome. Therefore, TEs may have evolved specific strategies for bypassing epigenetic control and allowing the emergence of new TE copies. Recent studies suggested that the epigenetic silencing can be, at least transiently, attenuated by heat stress in A. thaliana. Heat stress induced strong transcriptional activation of COPIA78 family LTR-retrotransposons named ONSEN, and even their transposition in mutants deficient in siRNA-biogenesis. ONSEN transcriptional activation was facilitated by the presence of heat responsive elements (HREs) within the long terminal repeats, which serve as a binding platform for the HEAT SHOCK FACTORs (HSFs). This thesis focused on the evolution of ONSEN heat responsiveness in Brassicaceae. By using whole-transcriptome sequencing approach, multiple Arabidopsis lyrata ONSENs with conserved heat response were found and together with ONSENs from other Brassicaceae were used to reconstruct the evolution of ONSEN HREs. This indicated ancestral situation with two, in palindrome organized, HSF binding motifs. In the genera Arabidopsis and Ballantinia, a local duplication of this locus increased number of HSF binding motifs to four, forming a high-efficiency HRE. In addition, whole transcriptome analysis revealed novel heat-responsive TE families COPIA20, COPIA37 and HATE. Notably, HATE represents so far unknown COPIA family which occurs in several Brassicaceae species but is absent in A. thaliana. Putative HREs were identified within the LTRs of COPIA20, COPIA37 and HATE of A. lyrata, and could be preliminarily validated by transcriptional analysis upon heat induction in subsequent survey of Brassicaeae species. Subsequent phylogenetic analysis indicated a repeated evolution of heat responsiveness within Brassicaceae COPIA LTR-retrotransposons. This indicates that acquisition of heat responsiveness may represent a successful strategy for survival of TEs within the host genome.

Comparative chromosome mapping of 5S rDNA and 5SHindIII repetitive sequences in Erythrinidae fishes (Characiformes) with emphasis on the Hoplias malabaricus 'species complex'

Chromosomal localization of 5S rDNA and 5SHindIII repetitive sequences was carried out in several representatives of the Erythrinidae family, namely in karyomorphs A, D, and F of Hoplias malabaricus, and in H. lacerdae, Hoplerythrinusunitaeniatus and Erythrinus erythrinus. The 5S rDNA mapped interstitially in two chromosome pairs in karyomorph A and in one chromosome pair in karyomorphs D and F and in H. lacerdae. The 5SHindIII repetitive DNA mapped to the centromeric region of several chromosomes (18 to 22 chromosomes) with variations related to the different karyomorphs of H. malabaricus. on the other hand, no signal was detected in the chromosomes of H. lacerdae, H. unitaeniatus and E. erythrinus, suggesting that the 5SHindIII-DNA sequences have originated or were lost after the divergence of H. malabaricus from the other erythrinid species. The chromosome distribution of 5S rDNA and 5SHindIII-DNA sequences contributes to a better understanding of the mechanisms of karyotype differentiation among the Erythrinidae members.Copyright (c) 2007 S. Karger AG, Basel.

Differentiation of the XY Sex Chromosomes in the Fish Hoplias malabaricus (Characiformes, Erythrinidae): Unusual Accumulation of Repetitive Sequences on the X Chromosome

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Chromosome mapping of repetitive sequences in Anostomidae species: Implications for genomic and sex chromosome evolution

Background: Members of the Anostomidae family provide an interesting model system for the study of the influence of repetitive elements on genome composition, mainly because they possess numerous heterochromatic segments and a peculiar system of female heterogamety that is restricted to a few species of the Leporinus genus. The aim of this study was to isolate and identify important new repetitive DNA elements in Anostomidae through restriction enzyme digestion, followed by cloning, characterisation and chromosome mapping of this fragment. To identify repetitive elements in other Leporinus species and expand on studies of repetitive elements in Anostomidae, hybridisation experiments were also performed using previously described probes of LeSpeI repetitive elements. Results: The 628-base pair (bp) LeSpeII fragment was hybridised to metaphase cells of L. elongatus individuals as well as those of L. macrocephalus, L. obtusidens, L. striatus, L. lacustris, L. friderici, Schizodon borellii and S. isognathus. In L. elongatus, both male and female cells contained small clusters of LeSpeII repetitive elements dispersed on all of the chromosomes, with enrichment near most of the terminal portions of the chromosomes. In the female sex chromosomes of L. elongatus (Z2,Z2/W1W 2), however, this repeated element was absent. In the remaining species, a dispersed pattern of hybridisation was observed on all chromosomes irrespective of whether or not they were sex chromosomes. The repetitive element LeSpeI produced positive hybridisations signals only in L. elongatus, L. macrocephalus and L. obtusidens, i.e., species with differentiated sex chromosomes. In the remaining species, the LeSpeI element did not produce hybridisation signals. Conclusions: Results are discussed in terms of the effects of repetitive sequences on the differentiation of the Anostomidae genome, especially with respect to sex chromosome evolution. LeSpeII showed hybridisation patterns typical of Long Interspersed Elements (LINEs). The differential distribution of this element may be linked to sex chromosome differentiation in L. elongatus species. The relationship between sex chromosome specificity and the LeSpeI element is confirmed in the species L. elongatus, L. macrocephalus and L. obtusidens. © 2012 da Silva et al.; licensee BioMed Central Ltd.

T-DNA tagging and characterisation of a novel meristem-specific promoter from tobacco

We have evaluated T-DNA mediated plant promoter tagging, with a left-border-linked promoterless firefly luciferase (luc) construct, as a strategy for the isolation of novel plant promoters. In a population of approximately 300 transformed tobacco plants, IO lines showed LUC activity, including novel tissue-specific and developmental patterns of expression. One line, showing LUC activity only in the shoot and root apical meristems, was further characterised. Inverse PCR was used to amplify a 1.5 kb fragment of plant DNA flanking the single-copy T-DNA insertion in this line. With the exception of a 249 bp highly repetitive element, this sequence is present as a single copy in the tobacco genome, and is not homologous to any previously characterised DNA sequences. Sequence analysis revealed the presence of several motifs that may be involved in transcriptional regulation. Transgenic tobacco plants transformed with a transcriptional fusion of this putative promoter sequence to the beta-glucuronidase (uidA) reporter gene, showed GUS activity confined to the shoot tip and mature pollen. This promoter may be useful to direct the expression of genes controlling the transition to flowering, or genes to reduce losses due to pests and stresses damaging plant apical meristems.

Low Satellite DNA Variability in Natural Populations of Drosophila antonietae Involved in Different Evolutionary Events

Drosophila antonietae is a cactophilic species that is found in the mesophilic forest of the Parana`-Paraguay river basin and in the dunes of the South Atlantic coast of Brazil. Although the genetic structure of the Parana`-Paraguay river basin populations has already been established, the relationship between these populations and those on the Atlantic coast is controversial. In this study, we compared 33 repetitive units of pBuM-2 satellite DNA isolated from individuals from 8 populations of D. antonietae in these geographic regions, including some populations found within a contact zone with the closely related D. serido. The pBuM-2 sequences showed low interpopulational variability. This result was interpreted as a consequence of both gene flow among the populations and unequal crossing over promoting homogenization of the tandem arrays. The results presented here, together with those of previous studies, highlight the use of pBuM-2 for solving taxonomic conflicts within the D. buzzatii species cluster.

A novel reiterated family of transcribed oligo(A)-terminated, interspersed DNA elements in the genome of Trypanosoma cruzi

We report the molecular characterization of a novel reiterated family of transcribed oligo(A)-terminated, interspersed DNA elements in the genome of Trypanosoma cruzi. Steady-state level of transcripts of this sequence family appeared to be developmentally regulated, since only in the replicative forms the parasite showed expression of related sequences with a major band around 3 kb. The presence of frame shifts or premature stop codons predicts that transcripts are not translated. The sequence family also contains truncated forms of retrotransposons elements that may become potential hot spots for retroelement insertion. Sequences homologous to this family are interspersed at many chromosomes including the subtelomeric regions.

Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp) sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Characterisation of an s-type low molecular weight glutenin subunit of wheat and its proline and glutamine-rich repetitive domain

The low molecular weight glutenin subunits (LMW-GS) are major components of the glutenin polymers which determine the elastomeric properties of wheat (Triticum aestivum L.) gluten and dough. They comprise a complex mixture of components and have proved to be difficult to purify for detailed characterisation. The mature LMW subunit proteins comprise two structural domains, with one domain consisting of repeated sequences based on short peptide motifs. DNA sequences encoding this domain and a whole subunit were expressed in Escherichia coli and the recombinant proteins purified. Detailed comparisons by spectroscopy (CD, FT-IR) and dynamic light scattering indicated that the repetitive and non-repetitive domains of the proteins formed different structures with the former having an extended conformation with an equilibrium between poly-L-proline II-like structure and type II’ b-turns, and the latter a more compact globular structure rich in a-helix. Although the structures of these two domains appear to form independently, dynamic light scattering of the whole subunit dissolved in trifluoroethanol(TFE) suggested that they interact, leading to a more compact conformation. These observations may have relevance to the role of the LMW-GS in gluten structure and functionality.

Chromosome polymorphism in Astyanax fasciatus (Teleostei, Characidae). 2-Chromosomal location of a satellite DNA

Studies about composition of repetitive sequences and their chromosomal location have been helpful to evolutionary studies in many distinct organisms. In order to keep on assessing the possible relationships among different cytotypes of Astyanax fasciatus (Teleostei, Characiformes) in the Mogi-Guacu River (Sao Paulo State, Brazil), C-banding, chromomycin A 3 staining, and fluorescent in situ hybridization with a repetitive DNA sequence (As51) isolated from Astyanax scabripinnis were performed in the present work. The constitutive heterochromatin was distributed in terminal regions on long arms of submetacentric, subtelocentric, and acrocentric chromosomes and in the terminal region on short arms of a pair of submetacentric chromosomes in both standard cytotypes. This latter heterochromatic site was also GC-rich, as revealed by chromomycin A(3) staining, corresponding to the nucleolar organizer region (NOR), as shown by previous studies. The sites of the satellite As51 DNA were located in terminal regions on long arms of several chromosomes. Some variant karyotypic forms, which diverge from the two standard cytotypes, also presented distinctive chromosomes carrying As51 satellite DNA. It is possible that the standard 2n = 46 cytotype represents an invader population in the Mogi-Guacu River able to interbreed with the resident standard 2n = 48 cytotype. Therefore, the variant karyotypes would be related to a possible viable offspring, where complementary chromosomal rearrangements could favor new locations of the satellite DNA analyzed. Copyright (C) 2008 S. Karger AG, Basel

Genomic organization and transcription analysis of the 195-bp satellite DNA in Trypanosoma cruzi

The 195-bp satellite DNA is the most abundant Trypanosoma cruzi repetitive sequence. Here we show by RNA blotting and RT-PCR that 195 SAT is intensely transcribed. We observed a positive correlation between the level of satellite RNA and the abundance of the satellite copies in the genome of T cruzi strains and that the satellite expression is not developmentally regulated. By analyzing CL Brener individual reads, we estimated that 195 SAT corresponds to approximately 5% of the CL Brener genome. 195 SAT elements were found in only 37 annotated contigs, indicating that a large number of satellite copies were not incorporated into the assembled data. The assembled satellite units are distributed in non-syntenic regions with Trypanosoma brucei and Leishmania major genomes, enriched with surface proteins, retroelements, RHS and hypothetical proteins. Satellite repeats were not observed in annotated subtelomeric regions. We report that 12 satellite sequences are truncated by the retroelement VIPER. (C) 2008 Elsevier B.V. All rights reserved.

Genomic organization of repetitive DNAs in the cichlid fish Astronotus ocellatus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)