977 resultados para Receptors, Interleukin-5


Relevância:

80.00% 80.00%

Publicador:

Resumo:

The major isoforms of the GABAA (gamma-aminobutyric acid type A) receptor are composed of two alpha, two beta and one gamma subunit. Thus alpha and beta subunits occur twice in the receptor pentamer. As it is well documented that different isoforms of alpha and beta subunits can co-exist in the same pentamer, the question is raised whether the relative position of a subunit isoform affects the functional properties of the receptor. We have used subunit concatenation to engineer receptors of well-defined subunit arrangement to study this question. Although all five subunits may be concatenated, we have focused on the combination of triple and dual subunit constructs. We review here what is known so far on receptors containing simultaneously alpha1 and alpha6 subunits and receptors containing beta1 and beta2 subunits. Subunit concatenation may not only be used to study receptors containing two different subunit isoforms, but also to introduce a point mutation into a defined position in receptors containing either two alpha or beta subunits, or to study the receptor architecture of receptors containing unconventional GABAA receptor subunits. Similar approaches may be used to characterize other members of the pentameric ligand-gated ion channel family, including nicotinic acetylcholine receptors, glycine receptors and 5-HT3 (5-hydroxytryptamine) receptors.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

BACKGROUND: The hypereosinophilic syndrome is a group of diseases characterized by persistent blood eosinophilia, defined as more than 1500 cells per microliter with end-organ involvement and no recognized secondary cause. Although most patients have a response to corticosteroids, side effects are common and can lead to considerable morbidity. METHODS: We conducted an international, randomized, double-blind, placebo-controlled trial evaluating the safety and efficacy of an anti-interleukin-5 monoclonal antibody, mepolizumab, in patients with the hypereosinophilic syndrome. Patients were negative for the FIP1L1-PDGFRA fusion gene and required prednisone monotherapy, 20 to 60 mg per day, to maintain a stable clinical status and a blood eosinophil count of less than 1000 per microliter. Patients received either intravenous mepolizumab or placebo while the prednisone dose was tapered. The primary end point was the reduction of the prednisone dose to 10 mg or less per day for 8 or more consecutive weeks. RESULTS: The primary end point was reached in 84% of patients in the mepolizumab group, as compared with 43% of patients in the placebo group (hazard ratio, 2.90; 95% confidence interval [CI], 1.59 to 5.26; P<0.001) with no increase in clinical activity of the hypereosinophilic syndrome. A blood eosinophil count of less than 600 per microliter for 8 or more consecutive weeks was achieved in 95% of patients receiving mepolizumab, as compared with 45% of patients receiving placebo (hazard ratio, 3.53; 95% CI, 1.94 to 6.45; P<0.001). Serious adverse events occurred in seven patients receiving mepolizumab (14 events, including one death; mean [+/-SD] duration of exposure, 6.7+/-1.9 months) and in five patients receiving placebo (7 events; mean duration of exposure, 4.3+/-2.6 months). CONCLUSIONS: Our study shows that treatment with mepolizumab, an agent designed to target eosinophils, can result in corticosteroid-sparing for patients negative for FIP1L1-PDGFRA who have the hypereosinophilic syndrome. (ClinicalTrials.gov number, NCT00086658 [ClinicalTrials.gov].).

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Although eosinophils are considered useful in defense mechanisms against parasites, their exact function in innate immunity remains unclear. The aim of this study is to better understand the role of eosinophils within the gastrointestinal immune system. We show here that lipopolysaccharide from Gram-negative bacteria activates interleukin-5 (IL-5)- or interferon-gamma-primed eosinophils to release mitochondrial DNA in a reactive oxygen species-dependent manner, but independent of eosinophil death. Notably, the process of DNA release occurs rapidly in a catapult-like manner--in less than one second. In the extracellular space, the mitochondrial DNA and the granule proteins form extracellular structures able to bind and kill bacteria both in vitro and under inflammatory conditions in vivo. Moreover, after cecal ligation and puncture, Il5-transgenic but not wild-type mice show intestinal eosinophil infiltration and extracellular DNA deposition in association with protection against microbial sepsis. These data suggest a previously undescribed mechanism of eosinophil-mediated innate immune responses that might be crucial for maintaining the intestinal barrier function after inflammation-associated epithelial cell damage, preventing the host from uncontrolled invasion of bacteria.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Animal studies have shown that behavioral responses to cocaine-related cues are altered by serotonergic medications. The effects of pharmacological agents on serotonin receptors 2a (5-HT2A) and 2c (5-HT2C), have yielded results suggesting that selective 5-HT2A antagonists and 5-HT2C agonists promote the disruption of cocaine-associated memories. One measure of cocaine related cues in humans is attentional bias, in which cocaine dependent individuals show greater response latency for cocaine related words than neutral words. Data from our laboratory shows that cocaine dependent subjects have altered attentional bias compared to controls. The purpose of this thesis was to investigate the role of the serotonin system in attentional bias and impulsivity in cocaine dependent individuals. We focused on the serotonin transporter, serotonin receptors 2A and 2C and tryptophan hydroxylase 1 and 2 (TPH1 and TPH2). We predicted that attentional bias and impulsivity would be higher in cocaine dependent individuals who had lower serotonin function. In the current study, we found a significant association between TPH2 genotype and attentional bias for the second block of the cocaine Stroop task. There was also a significant association between average attentional bias and HTTLPR genotype in the cocaine dependent individuals. The HT2C receptor genotype and attentional bias in our study sample also showed a significant difference. We did not find a significant difference between the serotonin 2A receptor variants or the TPH1 variants and attentional bias in the cocaine dependent group. In conclusion, the current study suggests that serotonergic medications should be utilized as pharmacotherapeutic treatment for cocaine addiction. Our results indicate that TPH2, the serotonin transporter and 2C receptor should be targeted in such a way as to modulate both, leading to increased synaptic serotonin function.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

At autopsy, Alzheimer's disease is characterised by the presence of amyloid plaques and neurofibrillary tangles, made up of two peptide sequences, amyloid-beta(1-40) (A beta 40) and amyloid-beta(1-42) (A beta 42). In Tyrode's solution (2 mM Ca2+), 10 mu M A beta 42 peptide almost immediately aggregates and eventually forms p-sheets. This aggregation can be inhibited with 4,5-dianilinophthalimide (DAPH). Ca2+-permeant AMPA receptors are involved in the neuronal Ca2+ influx (neurotoxicity) induced by the A beta 42 peptide in cultured neuronal cells. The Ca2+ influx observed with pre-incubated A beta 42 peptide was inhibited by DAPH. DAPH also inhibits epidermal growth factor receptor kinase, and this will prevent its development for use in Alzheimer's disease. The potential of DAPH as a small-molecule lead compound for the treatment of Alzheimer's disease next requires the separation of the structural requirements that reverse fibril formation and inhibit epidermal growth factor receptor kinase.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Background: Between 1961-1971 vitamin D deficiency was recognized as a public health issue in the UK, because of the lack of effective sunlight and the population mix [1, 2]. In recent years, health care professionals have cited evidence suggesting a re-emergence of the vitamin D deficiency linked to a number of health consequences as a concern [3-6]. Evidence from observational studies has linked low vitamin D status with impairment in glucose homeostasis and immune dysfunction [7-9]. However, interventional studies, particularly those focused on paediatric populations, have been limited and inconsistent. There is a need for detailed studies, to clarify the therapeutic benefits of vitamin D in these important clinical areas. Objective: The aims of this PhD thesis were two-fold. Firstly, to perform preliminary work assessing the association between vitamin D deficiency and bone status, glucose homeostasis and immune function, and to explore any changes in these parameters following short term vitamin D3 replacement therapy. Secondly, to assess the effectiveness of an electronic surveillance system (ScotPSU) as a tool to determine the current incidence of hospital-based presentation of childhood vitamin D deficiency in Scotland. Methods: Active surveillance was performed for a period of two years as a part of an electronic web-based surveillance programme performed by the Scottish Paediatric Surveillance Unit (ScotPSU). The validity of the system was assessed by identifying cases with profound vitamin D deficiency (in Glasgow and Edinburgh) from the regional laboratory. All clinical details were checked against those identified using the surveillance system. Thirty-seven children aged 3 months to 10 years, who had been diagnosed with vitamin D deficiency, were recruited for the bone, glucose and immunity studies over a period of 24 months. Twenty-five samples were analysed for the glucose and bone studies; of these, 18 samples were further analysed for immune study. Treatment consisted of six weeks taking 5000 IU units cholecalciferol orally once a day. At baseline and after completion of treatment, 25 hydroxyvitamin D (25(OH)D), parathyroid hormone (PTH), alkaline phosphatase (ALP), collagen type 1 cross-linked C-telopeptide (CTX), osteocalcin (OCN), calcium, phosphate, insulin, glucose, homeostasis model assessment index, estimated insulin resistance (HOMA IR), glycated hemoglobin (HbA1c), sex hormone binding globulin (SHBG), lipids profiles, T helper 1 (Th1) cytokines (interleukin-2 ( IL-2), tumor necrosis factors-alpha (TNF-α), interferon-gamma (INF-γ)), T helper 2 (Th2) cytokines (interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6)), T helper 17 (Th17) cytokine (interleukin-17 (IL-17)), Regulatory T (Treg) cytokine (interleukin-10 (IL-10)) and chemokines/cytokines, linked with Th1/Th2 subset balance and/or differentiation (interleukin-8 (IL-8), interleukin-12 (IL-12), eosinophil chemotactic protein ( EOTAXIN), macrophage inflammatory proteins-1beta (MIP-1β), interferon-gamma-induced protein-10 (IP-10), regulated on activation, normal T cell expressed and secreted (RANTES), monocyte chemoattractant protein-1(MCP-1)) were measured. Leukoocyte subset analysis was performed for T cells, B cells and T regulatory cells and a luminex assay was used to measure the cytokiens. Results: Between September 2009 and August 2011, 163 cases of vitamin D deficiency were brought to the attention of the ScotPSU, and the majority of cases (n = 82) were reported in Glasgow. The cross-validation checking in Glasgow and Edinburgh over a one-year period revealed only 3 (11%) cases of clearly symptomatic vitamin D deficiency, which had been missed by the ScotPSU survey in Glasgow. While 16 (67%) symptomatic cases had failed to be reported through the ScotPSU survey in Edinburgh. For the 23 children who are included in bone and glucose studies, 22 (96%) children had basal serum 25(OH)D in the deficiency range (< 50 nmol/l) and one (4%) child had serum 25(OH)D in the insufficiency range (51-75 nmol/l). Following vitamin D3 treatment, 2 (9%) children had final serum 25(OH)D lower than 50 nmol/l, 6 (26%) children had final serum 25(OH)D between >50-75 nmol/l, 12 (52%) children reached a final serum 25(OH)D >75-150 nmol/l and finally 3 (13%) exceeded the normal reference range with a final 25(OH)D >150 nmol/l. Markers for remodelling ALP and PTH had significantly decreased (p = 0.001 and <0.0001 for ALP and PTH respectively). In 17 patients for whom insulin and HOMA IR data were available and enrolled in glucose study, significant improvements in insulin resistance (p = 0.04) with a trend toward a reduction in serum insulin (p = 0.05) was observed. Of those 14 children who had their cytokines profile data analysed and enrolled in the immunity study, insulin and HOMA IR data were missed in one child. A significant increase in the main Th2 secreted cytokine IL-4 (p = 0.001) and a tendency for significant increases in other Th2 secreted cytokines IL-5 (p = 0.05) and IL-6 (p = 0.05) was observed following vitamin D3 supplementation. Conclusion: An electronic surveillance system can provide data for studying the epidemiology of vitamin D deficiency. However, it may underestimate the number of positive cases. Improving vitamin D status in vitamin D deficient otherwise healthy children significantly improved their vitamin D deficient status, and was associated with an improvement in bone profile, improvements in insulin resistance and an alteration in main Th2 secreting cytokines.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The high affinity receptor for human granulocyte-macrophage colony-stimulating factor (GM-CSF) consists of a cytokine-specific alpha-subunit (hGMR alpha) and a common signal-transducing beta-subunit (hpc) that is shared with the interleukin-3 and -5 receptors, We have previously identified a constitutively active extracellular point mutant of hpc, I374N, that can confer factor independence on murine FDC-P1 cells but not BAF-B03 or CTLL-2 cells (Jenkins, B. J., D'Andrea, R. J., and Gonda, T. J. (1995) EMBO J. 14, 4276-4287), This restricted activity suggested the involvement of cell type-specific signaling molecules in the activation of this mutant. We report here that one such molecule is the mouse GMR alpha (mGMR alpha) subunit, since introduction of mGMR alpha, but not hGMR alpha, into BAF-B03 or CTLL-2 cells expressing the I374N mutant conferred factor independence, Experiments utilizing mouse/human chimeric GMR alpha subunits indicated that the species specificity lies in the extracellular domain of GMRa. Importantly, the requirement for mGMR alpha correlated with the ability of I374N (but not wild-type hpc) to constitutively associate with mGMRa. Expression of I374N in human factor-dependent UT7 cells also led to factor-independent proliferation, with concomitant up-regulation of hGMR alpha surface expression. Taken together, these findings suggest a critical role for association with GMR alpha in the constitutive activity of I374N.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

IL-13 and eotaxin play important, inter-related roles in asthma models. In the lungs, CysLT, produced by the 5-LO-LTC4S pathway, mediate some local responses to IL-13 and eotaxin; in bone marrow, CysLT enhance IL-5-dependent eosinophil differentiation. We examined the effects of IL-13 and eotaxin on eosinophil differentiation. Semi-solid or liquid cultures were established from murine bone marrow with GM-CSF or IL-5, respectively, and the effects of IL-13, eotaxin, or CysLT on eosinophil colony formation and on eosinophil differentiation in liquid culture were evaluated, in the absence or presence of: a) the 5-LO inhibitor zileuton, the FLAP inhibitor MK886, or the CysLT1R antagonists, montelukast and MK571; b) mutations that inactivate 5-LO, LTC4S, or CysLT1R; and c) neutralizing mAb against eotaxin and its CCR3 receptor. Both cytokines enhanced GM-CSF-dependent eosinophil colony formation and IL-5-stimulated eosinophil differentiation. Although IL-13 did not induce eotaxin production, its effects were abolished by anti-eotaxin and anti-CCR3 antibodies, suggesting up-regulation by IL-13 of responses to endogenous eotaxin. Anti-CCR3 blocked eotaxin completely. The effects of both cytokines were prevented by zileuton, MK886, montelukast, and MK571, as well as by inactivation of the genes coding for 5-LO, LTC4S, and CysLT1R. In the absence of either cytokine, these treatments or mutations had no effect. These findings provide evidence for: a) a novel role of eotaxin and IL-13 in regulating eosinophilopoiesis; and b) a role for CysLTRs in bone marrow cells in transducing cytokine regulatory signals. J. Leukoc. Biol. 87: 885-893; 2010.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

To explore the possible involvement of STAT factors ("signal transducers and activators of transcription") in the interleukin 2 receptor (IL-2R) signaling cascade, murine HT-2 cells expressing chimeric receptors composed of the extracellular domain of the erythropoietin receptor fused to the cytoplasmic domains of the IL-2R beta or -gamma c chains were prepared. Erythropoietin or IL-2 activation of these cells resulted in rapid nuclear expression of a DNA-binding activity that reacted with select STAT response elements. Based on reactivity with specific anti-STAT antibodies, this DNA-binding activity was identified as a murine homologue of STAT-5. Induction of nuclear expression of this STAT-5-like factor was blocked by the addition of herbimycin A, a tyrosine kinase inhibitor, but not by rapamycin, an immunophilin-binding antagonist of IL-2-induced proliferation. The IL-2R beta chain appeared critical for IL-2-induced activation of STAT-5, since a mutant beta chain lacking all cytoplasmic tyrosine residues was incapable of inducing this DNA binding. In contrast, a gamma c mutant lacking all of its cytoplasmic tyrosine residues proved fully competent for the induction of STAT-5. Physical binding of STAT-5 to functionally important tyrosine residues within IL-2R beta was supported by the finding that phosphorylated, but not nonphosphorylated, peptides corresponding to sequences spanning Y392 and Y510 of the IL-2R beta tail specifically inhibited STAT-5 DNA binding.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

Objective. Patients with rheumatoid arthritis (RA) have increased concentrations of the amino acid glutamate in synovial fluid. This study was undertaken to determine whether glutamate receptors are expressed in the synovial joint, and to determine whether activation of glutamate receptors on human synoviocytes contributes to RA disease pathology. Methods. Glutamate receptor expression was examined in tissue samples from rat knee joints and in human fibroblast-like synoviocytes (FLS). FLS from 5 RA patients and 1 normal control were used to determine whether a range of glutamate receptor antagonists influenced expression of the proinflammatory cytokine interleukin-6 (IL-6), enzymes involved in matrix degradation and cytokine processing (matrix metalloproteinase 2 [MMP-2] and MMP-9), and the inhibitors of these enzymes (tissue inhibitor of metalloproteinases 1 [TIMP-1] and TIMP-2). IL-6 concentrations were determined by enzyme-linked immunosorbent assay, MMP activity was measured by gelatin zymography, and TIMP activity was determined by reverse zymography. Fluorescence imaging of intracellular calcium concentrations in live RA FLS stimulated with specific antagonists was used to reveal functional activation of glutamate receptors that modulated IL-6 or MMP-2. Results. Ionotropic and metabotropic glutamate receptor subunit mRNA were expressed in the patella, fat pad, and meniscus of the rat knee and in human articular cartilage. Inhibition of N-methyl-D-aspartate (NMDA) receptors in RA FLS increased proMMP-2 release, whereas non-NMDA ionotropic glutamate receptor antagonists reduced IL-6 production by these cells. Stimulation with glutamate, NMDA, or kainate (KA) increased intracellular calcium concentrations in RA FLS, demonstrating functional activation of specific ionotropic glutamate receptors. Conclusion. Our findings indicate that activation of NMDA and KA glutamate receptors on human synoviocytes may contribute to joint destruction by increasing IL-6 expression. © 2007, American College of Rheumatology.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Interleukin-22 (IL-22) is a class 2 cytokine whose primary structure is similar to that of interleukin 10 (IL-10) and interferon-gamma (IFN-gamma). IL-22 induction during acute phase immune response indicates its involvement in mechanisms of inflammation. Structurally different from IL-10 and a number of other members of IL-10 family, which form intertwined inseparable V-shaped dimers of two identical polypeptide chains, a single polypeptide chain of IL-22 folds on itself in a relatively globular structure. Here we present evidence, based on native gel electrophoresis, glutaraldehyde cross-linking, dynamic light scattering, and small angle x-ray scattering experiments, that human IL-22 forms dimers and tetramers in solution under protein concentrations assessable by these experiments. Unexpectedly, low-resolution molecular shape of IL-22 dimers is strikingly similar to that of IL-10 and other intertwined cytokine dimeric forms. Furthermore, we determine an ab initio molecular shape of the IL-22/IL-22R1 complex which reveals the V-shaped IL-22 dimer interacting with two cognate IL-22R1 molecules. Based on this collective evidence, we argue that dimerization might be a common mechanism of all class 2 cytokines for the molecular recognition with their respective membrane receptor. We also speculate that the IL-22 tetramer formation could represent a way to store the cytokine in nonactive form at high concentrations that could be readily converted into functionally active monomers and dimers upon interaction with the cognate cellular receptors.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Rationale Serotonin in the dorsal periaqueductal gray (DPAG) through the activation of 5-HT(1A) and 5-HT(2A) receptors inhibits escape, a defensive behavior associated with panic attacks. Long-term treatment with antipanic drugs that nonselectively or selectively blocks the reuptake of serotonin (e.g., imipramine and fluoxetine, respectively) enhances the inhibitory effect on escape caused by intra-DPAG injection of 5-HT(1A) and 5-HT(2A) receptor agonists. It has been proposed that these compounds exert their effect on panic by facilitating 5-HT-mediated neurotransmission in the DPAG. Objectives The objective of this study was to investigate whether facilitation of 5-HT neurotransmission in the DPAG is also observed after treatment with alprazolam, a pharmacologically distinct antipanic drug that acts primarily as a high potency benzodiazepine receptor agonist. Materials and methods Male Wistar rats, subchronically (3-6 days) or chronically (14-17 days) treated with alprazolam (2 and 4 mg/kg, i.p.) were intra-DPAG injected with (+/-)-8-hydroxy-2-(di-n-propylamino)tetralin hydrobromide (8-OH-DPAT), (+/-)-1-(2,5-dimethoxy-4-iodophenyl) piperazine dihydrochloride (DOI), and midazolam, respectively, 5-HT(1A), 5-HT(2A/2C), and benzodiazepine receptor agonists. The intensity of electrical current that needed to be applied to the DPAG to evoke escape behavior was measured before and after the microinjection of these agonists. Results Intra-DPAG injection of the 5-HT agonists and midazolam increased the escape threshold in all groups of animals tested, indicating a panicolytic-like effect. The inhibitory effect of 8-OH-DPAT and DOI, but not midazolam, was significantly higher in animals receiving long-, but not short-term treatment with alprazolam. Conclusions Alprazolam as antidepressants compounds facilitates 5-HT(1A)- and 5-HT(2A)-receptor-mediated neurotransmission in the DPAG, implicating this effect in the mode of action of different classes of antipanic drugs.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Background and purpose: The effects of centrally administered cannabinoids on body core temperature (Tc) and the contribution of endogenous cannabinoids to thermoregulation and fever induced by lipopolysaccharide (LPS) (Sigma Chem. Co., St. Louis, MO, USA) were investigated. Experimental approach: Drug-induced changes in Tc of male Wistar rats were recorded over 6 h using a thermistor probe (Yellow Springs Instruments 402, Dayton, OH, USA) inserted into the rectum. Key results: Injection of anandamide [(arachidonoylethanolamide (AEA); Tocris, Ellisville, MO, USA], 0.01-1 mu g i.c.v. or 0.1-100 ng intra-hypothalamic (i.h.), induced graded increases in Tc (peaks 1.5 and 1.6 degrees C at 4 h after 1 mu g i.c.v. or 10 ng i.h.). The effect of AEA (1 mu g, i.c.v.) was preceded by decreases in tail skin temperature and heat loss index (values at 1.5 h: vehicle 0.62, AEA 0.48). Bell-shaped curves were obtained for the increase in Tc induced by the fatty acid amide hydrolase inhibitor [3-(3-carbamoylphenyl)phenyl] N-cyclohexylcarbamate (Cayman Chemical Co., Ann Arbor, MI, USA) (0.001-1 ng i.c.v.; peak 1.9 degrees C at 5 h after 0.1 ng) and arachidonyl-2-chloroethylamide (ACEA; Tocris) (selective CB(1) agonist; 0.001-1 mu g i.c.v.; peak 1.4 degrees C 5 h after 0.01 mu g), but (R,S)-(+)-(2-Iodo-5-nitrobenzoyl)-[1-(1-methyl-piperidin-2-ylmethyl)-1H-indole-3-yl] methanone (Tocris) (selective CB(2) agonist) had no effect on Tc. AEA-induced fever was unaffected by i.c.v. pretreatment with 6-Iodo-2-methyl-1-[2-(4-morpholinyl)ethyl]-1H-indole-3-yl](4-methoxyphenyl) methanone (Tocris) (selective CB(2) antagonist), but reduced by i.c.v. pretreatment with N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251; Tocris) (selective CB(1) antagonist). AM251 also reduced the fever induced by ACEA or LPS. Conclusions and implications: The endogenous cannabinoid AEA induces an integrated febrile response through activation of CB(1) receptors. Endocannabinoids participate in the development of the febrile response to LPS constituting a target for antipyretic therapy.