Effect of iodide on Fas, Fas-ligand and Bcl-w mRNA expression in thyroid of NOD mice pretreated with methimazole

Nonobese diabetic (NOD) mice and a derived strain, NOD.H.2h4, have been used as a model for experimental spontaneous thyroiditis and thyroiditis induced by iodide excess after a goiter-inducing period. Some authors have proposed that iodide, given after methimazole or propylthiouracil, is capable of inducing apoptosis in thyroid cells and that anti-thyroid drugs can modulate the expression of apoptosis components such as Fas and its ligand (Fas-L). Here we evaluated the effect of potassium iodide (20 µg/animal for 4 days, ip) given to NOD mice at the 10th week of life after exposure to methimazole (1 mg/ml) in drinking water from the 4th to the 10th week of life. Fas, Fas-L and Bcl-w expression were analyzed semiquantitatively by RT-PCR immediately after potassium iodide administration (group MI44D) or at week 32 (MI32S). Control groups were added at 10 (C10) and 32 weeks (C32), as well as a group that received only methimazole (CM10). An increase in the expression of Fas-L and Bcl-w (P<0.01, ANOVA) was observed in animals of group MI44D, while Fas was expressed at higher levels (P = 0.02) in group C32 (72.89 ± 47.09 arbitrary units) when compared to group C10 (10.8 ± 8.55 arbitrary units). Thus, the analysis of Fas-L and Bcl-w expression in the MI44D group and Fas in group C32 allowed us to detect two different patterns of expression of these apoptosis components in thyroid tissue of NOD mice.

ß-Spectrin São PauloII, a novel frameshift mutation of the ß-spectrin gene associated with hereditary spherocytosis and instability of the mutant mRNA

Hereditary spherocytosis (HS) is a common inherited anemia characterized by the presence of spherocytic red cells. Defects in several membrane protein genes have been involved in the pathogenesis of HS. ß-Spectrin-related HS seems to be common. We report here a new mutation in the ß-spectrin gene coding region in a patient with hereditary spherocytosis. The patient presented acanthocytosis and spectrin deficiency and, at the DNA level, a novel frameshift mutation leading to HS, i.e., a C deletion at codon 1392 (ß-spectrin São PauloII), exon 20. The mRNA encoding ß-spectrin São PauloII was very unstable and the mutant protein was not detected in the membrane or in other cellular compartments. It is interesting to note that frameshift mutations of the ß-spectrin gene at the 3' end allow the insertion of the mutant protein in the red cell membrane, leading to a defect in the auto-association of the spectrin dimers and consequent elliptocytosis. On the other hand, ß-spectrin São PauloII protein was absent in the red cell membrane, leading to spectrin deficiency, HS and the presence of acanthocytes.

Kinetics of TNF-alpha and IFN-gamma mRNA expression in islets and spleen of NOD mice

Insulin-dependent diabetes mellitus is caused by autoimmune destruction of pancreatic ß cells. Non-obese diabetic (NOD) mice spontaneously develop diabetes similar to the human disease. Cytokines produced by islet-infiltrating mononuclear cells may be directly cytotoxic and can be involved in islet destruction coordinated by CD4+ and CD8+ cells. We utilized a semiquantitative RT-PCR assay to analyze in vitro the mRNA expression of TNF-alpha and IFN-gamma cytokine genes in isolated islets (N = 100) and spleen cells (5 x 10(5) cells) from female NOD mice during the development of diabetes and from female CBA-j mice as a related control strain that does not develop diabetes. Cytokine mRNAs were measured at 2, 4, 8, 14 and 28 weeks of age from the onset of insulitis to the development of overt diabetes. An increase in IFN-gamma expression in islets was observed for females aged 28 weeks (149 ± 29 arbitrary units (AU), P<0.05, Student t-test) with advanced destructive insulitis when compared with CBA-j mice, while TNF-alpha was expressed in both NOD and CBA-j female islets at the same level at all ages studied. In contrast, TNF-alpha in spleen was expressed at higher levels in NOD females at 14 weeks (99 ± 8 AU, P<0.05) and 28 weeks (144 ± 17 AU, P<0.05) of age when compared to CBA-j mice. The data suggest that IFN-gamma and TNF-alpha expression in pancreatic islets of female NOD mice is associated with ß cell destruction and overt diabetes.

Expression of CYP2A3 mRNA and its regulation by 3-methylcholanthrene, pyrazole, and ß-ionone in rat tissues

Cytochrome P450 (CYP) 2A enzymes are involved in the metabolism of numerous drugs and hormones and activate different carcinogens. Human CYP2A6, mouse CYP2A5 and rat CYP2A3 are orthologous enzymes that present high similarity in their amino acid sequence and share substrate specificities. However, different from the human and mouse enzyme, CYP2A3 is not expressed in the rat liver. There are limited data about expression of CYP2A3 in extrahepatic tissues and its regulation by typical CYP inducers. Therefore, the objective of the present study was to analyze CYP2A3 mRNA expression in different rat tissues by RT-PCR, and to study the influence of 3-methylcholanthrene, pyrazole and ß-ionone treatment on its expression. Male Wistar rats were divided into four groups of 5 rats each, and were treated ip for 4 days with 3-methylcholanthrene (25 mg/kg body weight), pyrazole (150 mg/kg body weight), ß-ionone (1 g/kg body weight), or vehicle. Total RNA was extracted from tissues and CYP2A3 mRNA levels were analyzed by semiquantitative RT-PCR. CYP2A3 mRNA was constitutively expressed in the esophagus, lung and nasal epithelium, but not along the intestine, liver, or kidney. CYP2A3 mRNA levels were increased in the esophagus by treatment with 3-methylcholanthrene and pyrazole (17- and 7-fold, respectively), in lung by pyrazole and ß-ionone (3- and 4-fold, respectively, although not statistically significant), in the distal part of the intestine and kidney by 3-methylcholanthrene and pyrazole, and in the proximal part of the intestine by pyrazole. CYP2A3 mRNA was not induced in nasal epithelium, liver or in the middle part of the intestine. These data show that, in the rat, CYP2A3 is constitutively expressed in several extrahepatic tissues and its regulation occurs through a complex mechanism that is essentially tissue specific.

Interferon-alpha receptor 1 mRNA expression in peripheral blood mononuclear cells is associated with response to interferon-alpha therapy of patients with chronic hepatitis C

Interferon (IFN)-alpha receptor mRNA expression in liver of patients with chronic hepatitis C has been shown to be a response to IFN-alpha therapy. The objective of the present study was to determine whether the expression of mRNA for subunit 1 of the IFN-alpha receptor (IFNAR1) in peripheral blood mononuclear cells (PBMC) is associated with the response to IFN-alpha in patients with chronic hepatitis C. Thirty patients with positive anti-HCV and HCV-RNA, and abnormal levels of alanine aminotransferase in serum were selected and treated with IFN-alpha2b for one year. Those with HBV or HIV infection, or using alcohol were not included. Thirteen discontinued the treatment and were not evaluated. The IFN-alpha response was monitored on the basis of alanine aminotransferase level and positivity for HCV-RNA in serum. IFNAR1-mRNA expression in PBMC was measured by reverse transcription-polymerase chain reaction before and during the first three months of therapy. The results are reported as IFNAR1-mRNA/ß-actin-mRNA ratio (mean ± SD). Before treatment, responder patients had significantly higher IFNAR1-mRNA expression in PBMC (0.67 ± 0.15; N = 5; P < 0.05) compared to non-responders (0.35 ± 0.17; N = 12) and controls (0.30 ± 0.16; N = 9). Moreover, IFNAR1-mRNA levels were significantly reduced after 3 months of treatment in responders, whereas there were no differences in IFNAR1 expression in non-responders during IFN-alpha therapy. Basal IFNAR1-mRNA expression was not correlated with the serum level of alanine and aspartate aminotransferases or the presence of cirrhosis. The present results suggest that IFNAR1-mRNA expression in PBMC is associated with IFN-alpha response to hepatitis C and may be useful for monitoring therapy in patients with chronic hepatitis C.

Swimming training down-regulates plasma leptin levels, but not adipose tissue ob mRNA expression

The aim of the present study was to assess the effects of endurance training on leptin levels and adipose tissue gene expression and their association with insulin, body composition and energy intake. Male Wistar rats were randomly divided into two groups: trained (N = 18) and sedentary controls (N = 20). The trained group underwent swimming training for 9 weeks. Leptin and insulin levels, adiposity and leptin gene expression in epididymal and inguinal adipose tissue were determined after training. There were no differences in energy intake between groups. Trained rats had a decreased final body weight (-10%), relative and total body fat (-36 and -55%, respectively) and insulin levels (-55%) compared with controls (P < 0.05). Although trained animals showed 56% lower leptin levels (2.58 ± 1.05 vs 5.89 ± 2.89 ng/mL in control; P < 0.05), no difference in leptin gene expression in either fat depot was demonstrable between groups. Stepwise multiple regression analysis showed that lower leptin levels in trained rats were due primarily to their lower body fat mass. After adjustment for total body fat, leptin levels were still 20% (P < 0.05) lower in exercised rats. In conclusion, nine weeks of swimming training did not affect leptin gene expression, but did lead to a decrease in leptin levels that was independent of changes in body fat.

Influence of progesterone on GAD65 and GAD67 mRNA expression in the dorsolateral striatum and prefrontal cortex of female rats repeatedly treated with cocaine

Female rats are intensely affected by cocaine, with estrogen probably playing an important role in this effect. Progesterone modulates the GABA system and attenuates the effects of cocaine; however, there is no information about its relevance in changing GABA synthesis pathways after cocaine administration to female rats. Our objective was to investigate the influence of progesterone on the effects of repeated cocaine administration on the isoenzymes of glutamic acid decarboxylase (GAD65 and GAD67) mRNA in brain areas involved in the addiction circuitry. Ovariectomized, intact and progesterone replacement-treated female rats received saline or cocaine (30 mg/kg, ip) acutely or repeatedly. GAD isoenzyme mRNA levels were determined in the dorsolateral striatum (dSTR) and prefrontal cortex (PFC) by RT-PCR, showing that repeated, but not acute, cocaine decreased GADs/β-actin mRNA ratio in the dSTR irrespective of the hormonal condition (GAD65: P < 0.001; and GAD67: P = 0.004). In the PFC, repeated cocaine decreased GAD65 and increased GAD67 mRNA ratio (P < 0.05). Progesterone replacement decreased both GAD isoenzymes mRNA ratio after acute cocaine in the PFC (P < 0.001) and repeated cocaine treatment reversed this decrease (P < 0.001). These results suggest that cocaine does not immediately affect GAD mRNA expression, while repeated cocaine decreases both GAD65 and GAD67 mRNA in the dSTR of female rats, independently of their hormonal conditions. In the PFC, repeated cocaine increases the expression of GAD isoenzymes, which were decreased due to progesterone replacement.

Estradiol-induced hypophagia is associated with the differential mRNA expression of hypothalamic neuropeptides

Estradiol participates in the control of energy homeostasis, as demonstrated by an increase in food intake and in body weight gain after ovariectomy in rats. In the present study, female Wistar rats (200-230 g, N = 5-15 per group), with free access to chow, were individually housed in metabolic cages. We investigated food intake, body weight, plasma leptin levels, measured by specific radioimmunoassay, and the hypothalamic mRNA expression of orexigenic and anorexigenic neuropeptides, determined by real-time PCR, in ovariectomized rats with (OVX+E) and without (OVX) estradiol cypionate treatment (10 µg/kg body weight, sc, for 8 days). Hormonal and mRNA expression were determined at pre-feeding and 4 h after food intake. OVX+E rats showed lower food intake, less body weight gain and lower plasma leptin levels. In the OVX+E group, we also observed a reduction of neuropeptide Y (NPY), agouti-related protein (AgRP) and cocaine- and amphetamine-regulated transcript (CART) mRNA expression in the arcuate nucleus and a decrease in orexin A in the lateral hypothalamic area (LHA). There was an increase in leptin receptor (LepRb), melanocortin-4 receptor (MC4-R), CART, and mainly corticotropin-releasing hormone (CRH) mRNA in the paraventricular nucleus and LepRb and CART mRNA in the LHA. These data show that hypophagia induced by estradiol treatment is associated with reduced hypothalamic expression of orexigenic peptides such as NPY, AgRP and orexin A, and increased expression of the anorexigenic mediators MC4-R, LepRb and CRH. In conclusion, estradiol decreases food intake, and this effect seems to be mediated by peripheral factors such as leptin and the differential mRNA expression of neuropeptides in the hypothalamus.

In vivo fluctuation of Tax, Foxp3, CTLA-4, and GITR mRNA expression in CD4+CD25+ T cells of patients with human T-lymphotropic virus type 1-associated myelopathy

HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.

Hypothyroidism decreases proinsulin gene expression and the attachment of its mRNA and eEF1A protein to the actin cytoskeleton of INS-1E cells

The actions of thyroid hormone (TH) on pancreatic beta cells have not been thoroughly explored, with current knowledge being limited to the modulation of insulin secretion in response to glucose, and beta cell viability by regulation of pro-mitotic and pro-apoptotic factors. Therefore, the effects of TH on proinsulin gene expression are not known. This led us to measure: a) proinsulin mRNA expression, b) proinsulin transcripts and eEF1A protein binding to the actin cytoskeleton, c) actin cytoskeleton arrangement, and d) proinsulin mRNA poly(A) tail length modulation in INS-1E cells cultured in different media containing: i) normal fetal bovine serum - FBS (control); ii) normal FBS plus 1 µM or 10 nM T3, for 12 h, and iii) FBS depleted of TH for 24 h (Tx). A decrease in proinsulin mRNA content and attachment to the cytoskeleton were observed in hypothyroid (Tx) beta cells. The amount of eEF1A protein anchored to the cytoskeleton was also reduced in hypothyroidism, and it is worth mentioning that eEF1A is essential to attach transcripts to the cytoskeleton, which might modulate their stability and rate of translation. Proinsulin poly(A) tail length and cytoskeleton arrangement remained unchanged in hypothyroidism. T3 treatment of control cells for 12 h did not induce any changes in the parameters studied. The data indicate that TH is important for proinsulin mRNA expression and translation, since its total amount and attachment to the cytoskeleton are decreased in hypothyroid beta cells, providing evidence that effects of TH on carbohydrate metabolism also include the control of proinsulin gene expression.

Leptin receptor (Ob-R) mRNA expression and serum leptin concentration in patients with colorectal and metastatic colorectal cancer

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Downregulation of TIM-3 mRNA expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus

The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

B cells expressing IL-10 mRNA modulate memory T cells after DNA-Hsp65 immunization

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

A Survey of hMLH1 mRNA Splicing Profiles in Human Cell Lines: Comparing Primary Cultured Fibroblasts Before and After Oxidative Stress and Transiently versus Stably Demethylated Colon Cancer Derived Cell Lines

Most human genes undergo alternative splicing and loss of splicing fidelity is associated with disease. Epigenetic silencing of hMLH 1 via promoter cytosine methylation is causally linked to a subset of sporadic non-polyposis colon cancer and is reversible by 5-aza-2' -deoxycytidine treatment. Here I investigated changes in hMLHI mRNA splicing profiles in normal fibroblasts and colon cancer-derived human cell lines. I established the types and frequencies of hMLHI mRNA transcripts generated under baseline conditions, after hydrogen peroxide induced oxidative stress, and in acutely 5-aza-2' -deoxycytidine-treated and stably derepressed cancer cell lines. I found that hMLHI is extensively spliced under all conditions including baseline (50% splice variants), the splice variant distribution changes in response to oxidative stress, and certain splice variants are sensitive to 5- aza-2' -deoxycytidine treatment: Splice variant diversity and frequency of exon 17 skipping correlates with the level of hMLHI promoter methylation suggesting a link between promoter methylation and mRNA splicing.