1000 resultados para Bovino - Inseminação artificial - Aspectos endócrinos
Resumo:
Este trabalho avaliou a eficiência reprodutiva de vacas mestiças leiteiras submetidas a sistemas de criação com e sem sombreamento, em Bujarú, Pará. Foram utilizadas 54 vacas mestiças leiteiras, em lactação, pluríparas, com bezerro ao pé, distribuídas de modo inteiramente casualizado, em dois grupos experimentais (com sombra – CS e sem sombra – SS), cada grupo com 27 animais. Entre 30 a 35 dias pós-parto, os animais foram submetidos à inseminação artificial, em tempo fixo, as fêmeas que repetiram estro foram inseminadas convencionalmente e após uma semana, repassadas a um touro de fertilidade conhecida. O diagnóstico de prenhez foi realizado aos 60 dias, por palpação retal, após os três serviços. Os animais foram manejados em pastejo rotacionado de Brachiaria brizantha, com água e sal mineral ad libitum. Durante o período experimental, os dados de temperatura ambiente foram registrados, com auxílio de termômetro digital, instalado no microclima de cada piquete, nos grupos experimentais (CS e SS). As variáveis fisiológicas avaliadas, tais como temperatura retal (TR), temperatura da superfície corporal (TSC) e frequência respiratória (FR), foram coletadas uma vez por semana, no período da manhã, com duração de duas horas de coleta. Amostras de sangue foram coletadas, uma vez por semana, através de punção na veia coccígea, e armazenadas em tubos de ensaio de vidro de 10 ml, com anticoagulante Heparina Sódica (5.000UI/5.0ml). Essas amostras de sangue foram centrifugadas, durante sete minutos a 5.000 r.p.m. O plasma obtido foi imediatamente acondicionado em microtubos de polietileno de 2.0 ml, devidamente identificados com a numeração de cada animal e conservados a -20°C, até o momento da análise para aferir os níveis de cortisol. Através da análise de variância foram observadas diferenças significativas (p<0,01) entre os grupos CS e SS para as variáveis fisiológicas TR, FR e TSC, sendo encontrados resultados menores para esses parâmetros estudados nos animais submetidos ao sombreamento. Da mesma forma, houve influência dos tratamentos (p<0,01) nos valores de cortisol, sendo menor no grupo com sombra. Em relação à taxa de prenhez das fêmeas do grupo com sombra em relação ao grupo sem sombra, não houve diferença significativa (p²= 0,1628). Porém, houve diferença estatística (p²= 0,0034) em relação à taxa de prenhez de vacas leiteiras que tiveram o nível de cortisol medido, sendo maior nos animais que apresentaram menor concentração plasmática de cortisol. Na maioria dos resultados não houve correlação entre os parâmetros estudados (variáveis fisiológicas, concentração hormonal de cortisol e temperatura ambiente) de vacas criadas em sistema com e sem sombreamento, em clima Amazônico, à exceção da FR com a concentração de cortisol, sendo encontrada uma correlação positiva média entre esses dois parâmetros no grupo com sombra e a TR apresentou correlação positiva média com a FR e alta com a TSC, e a TSC positiva alta com a FR no grupo sem sombra. Dessa forma, o uso ou não do sombreamento influenciou na eficiência reprodutiva. O não sombreamento interferiu na taxa de prenhez. O sombreamento proporcionou aos animais, manutenção das variáveis fisiológicas mais próximas da normalidade. Assim como, manteve o nível de cortisol das fêmeas do grupo com sombra mais baixo.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Medicina Veterinária - FMVZ
Resumo:
Pós-graduação em Medicina Veterinária - FMVZ
Resumo:
Pós-graduação em Ciências Biológicas (Farmacologia) - IBB
Resumo:
Pós-graduação em Medicina Veterinária - FMVZ
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Pós-graduação em Genética e Melhoramento Animal - FCAV
Resumo:
Hypothyroidism is a common endocrine disorder in dogs caused by insufficient production and secretion of thyroid hormones. Most affected dogs have primary hypothyroidism that results from lymphocytic thyroiditis, idiopathic thyroid atrophy, or more rarely, neoplastic destruction. Secondary hypothyroidism resulting from inadequate secretion of thyrotropin (thyroid-stimulating hormone –TSH) from the pituitary gland is less commonly recognized. Tertiary hypothyroidism resulting from a deficiency of hypothalamic thyrotropin-releasing hormone (TRH) has not been documented in dogs. The diagnosis of hypothyroidism in dogs is made on the basis of clinical findings, results of routine laboratory and thyroid gland function tests and response to thyroid hormone replacement. Unfortunately, these tests have high sensitivity, but low specificity, for use in the diagnosis of hypothyroidism. Thyroid hormone supplementation is indicated for the treatment of confirmed hypothyroidism and for the diagnoses of the disease through clinical response to trial therapy
Resumo:
The dairy sector has undergone considerable economic losses due to low fertility rates due to adverse effects of heat stress on reproduction of cows. Genetic selection for increased production, coupled with the expanding dairy to tropical areas of the planet, and global warming has further aggravated the problem of heat stress. The effects of heat stress are multifactorial and act directly or indirectly at various levels of reproductive tissues, resulting in low fertility of cows, which in practice, results in reduced reproductive efficiency in the property, reducing the producers’ profit. Some strategies related to breeding biotechnology such as fixed-time artificial insemination, embryo transfer and use of BST, can minimize these effects and improve the reproductive efficiency of the herd
Resumo:
Methods of semen cryopreservation allow changes in spermatic cells, such as damage in plasma and acrossomal membrane and modifications in mitochondrial function due to a disorder in the lipidic bilayer. For effective oocyte fertilization, spermatozoa require functional competent membranes, and intact organelles, acrosome and DNA. However, most laboratory methods used to evaluate semen quality are not highly correlated with fertilizing capacity. The discovery of a variety of fluorochromes and compounds conjugated to fluorescent probes has enabled an accurate assessment of the viability, integrity and function of spermatozoa. Among the most used probes that label the various compartments of the sperm cell there are the membrane impermeable fluorescent dyes to test the membrane integrity, as well as acylated dyes that pass the intact membrane. For the acrossomal integrity the most commonly used method is lectins labeled by a fluorescent probe. The acrosome reaction and spermatic capacitation is detected by the evaluation of membrane architecture and disorder of lipids in plasma membrane. Mitochondrial function can be determined using markers for their aerobic activity. The DNA status of spermatozoa has been determined using the metachromatic properties of Acridine Orange, and the DNA fragmentation can also be assessed by TUNEL assay. Finally, DNA condensation is analyzed using a single cell DNA gel electrophoresis assay that indicates DNA compactation. This monograph aims to compile the various tests used to detect damaged spermatozoa under cryopreservation methods, searching for improve the predictive value of semen analysis with the intention of a successful conception
Resumo:
To assess the possibility of shifting the sex ratio at birth, since this can contribute to enhancing the genetic gain and producity in cattle, this work is aimed at raising the factors that may influence sex determination of creates. This study is based on research conducted in the area of reproduction and production of beef and dairy cattle, some quotes in humans, mouse, dogs and a study in pigs. This was due to back of data and studies in the bovine species. It was noted that stress during pregnancy, intake of vitamin C or others substances and the time of artificial insemination are the factors that may influence the determination of the type of product. Human studies, concluded that woman more stressed are more likely to produce female children of the quietest. Furthermore, sows that received ascorbic a ad orally for seven days and were inseminated during this period, produce more female then those who did not receive the vitamin. These studies may suggest that cows can also suffer influence of stress and food for the determination of sex of calf. There are also studies suggesting that cows inseminated at the earliest time of ovulation ted to produce more male calves than those inseminated a few hours before that time. Some scholars considers the hypothesis... (Complete abstract click electronic access below)
Resumo:
Currently, Brazil has one of the largest cattle herds worldwide. In order to keep that milk and meat were introduced reproductive biotechnologies such as artificial insemination, embryo transfer and in vitro fertilization. In certain situations the technique may have undesired effect, for example, the production of calve calves due to the very large increase in the gestation period when performed in vitro fertilization. To avoid this problem we perform the induction of labor in order to prevent the product is longer the womb. This induction can also be made in case of diseases that compromise the life of the mother, twin pregnancy an abnormal size calf. The administration of short acting steroids, prostaglandins, association of short acting steroids and prostaglandins and association of short acting steroids, prostaglandins and long-acting corticosteroids are some of the possibilities of induction
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
A bovinocultura é um dos principais destaques dentro do universo pecuário brasileiro e mundial, uma vez que o rebanho nacional é detentor do expressivo número de 200 milhões de cabeças entre as atividades de corte e leite, produzindo um valor bruto estimado em 67 bilhões de reais. Ainda assim, a pecuária de corte nacional apresenta baixos índices produtivos por continuar sendo conduzida, ao menos em considerável parcela do país, como uma atividade extrativista que emprega reduzido uso de insumos e biotecnologias, como inseminação artificial, transferência de embriões, fertilização in vitro e inseminação artificial em tempo fixo. No atual cenário mundial, essa característica da bovinocultura brasileira necessita ser alterada para que a atividade torne-se ainda mais rentável e competitiva. Neste caso, a pecuária de corte nacional terá que se apoiar no aumento de sua eficiência reprodutiva e produtiva, tendo como principais alternativas para atingir tal objetivo a elevação do número de vacas com estro no início da estação de monta, o aumento na taxa de concepção no primeiro serviço e a redução no intervalo entre partos, de improdutivos 21 meses para um ano, tempo considerado ideal e de máxima eficiência reprodutiva de um rebanho. Assim sendo, torna-se imprescindível elencar os principais fatores prolongadores do intervalo entre partos para, somente depois, instituir um ou mais métodos para se reduzir essa eficiência reprodutiva e finalmente impulsionar ainda mais a pecuária bovina brasileira