1000 resultados para Bovino - Diagnóstico de dor


Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

There can be several indicators of violence in society. However, in no other health unit such violence acquires visibility as in emergency. This study aimed to examine whether there is divergence between the history of medical consultation and diagnosis of physical aggressions in the emergency unit. A cross-sectional study was conducted in an emergency unit in the city of Araçatuba, state of São Paulo, Brazil, based on medical records, considering data on patients, lesions, history, diagnosis and treatment. Out of 133,537 visits, only 153 were recorded as physical aggressions, and 161 informed violence in the history of the consultation; 59.6% were male, 60.6% were between 20 and 44 years old. Excoriations, pain and injury predominated. There were no associations between state violence in the diagnosis and the characteristics of patients and visits (schedule, routing, gender, age). The conclusion is that in most cases violence reported in the history of the consultation was not mentioned in the diagnosis of injuries. The characteristics of care and patients were not related to the fact that professionals diagnosed the case as violence.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Pós-graduação em Biologia Geral e Aplicada - IBB

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

There are diseases in vertebrates associated with the structure of bone tissue that directly affect the locomotor system of the animal. Being a endoskeleton, the diagnosis of these diseases becomes difficult in vivo. The characterization of the physical structure of the bone tissue of healthy animals becomes a major tool in the diagnosis comparison of live animals. Thus, the objective of this work is to determine the average value of the key physical properties of the bone structure used in the clinical diagnosis, such as: bone density, porosity, and mass attenuation coefficient of 59.6 keV photons of bone tissue and bovine and equine check variations in these values. The samples were provided by the pathology department of the Faculty of Veterinary Medicine and Zootechny of Botucatu-SP, which are of one male equine and one female bovine animals, using the radio and metacarpus, together with these materials were supplied the historic them. They were withdrawn ten samples in cuts of 10cm over the bone . These samples were submitted to the wet method of immersion in water for the density, by the method of attenuation of gamma radiation of radioisotope 241Am, it is estimated the mass attenuation coefficient, and then were dried in the oven for determining the content moisture. In determining the porosity of the samples was tight ground, in order to obtain the density of particles. The results for the mass attenuation coefficient of gamma radiation to the levels of saturated humidity, environment humidity, dry humidity respectively 0289 ± 0039; 0286 ± 0040 and 0297 ± 0042. And the density of particles was 2.2691 g/cm3

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FCAV

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A pecuária leiteira vem sofrendo ao longo dos últimos anos, constantes mudanças com o intuito de maximizar a produção. A contínua seleção para uma maior produção de leite em conjunto com o aumento da capacidade digestiva e profundidade corporal aumentou a susceptibilidade de ocorrência de várias enfermidades abomasais, como o deslocamento do abomaso. O deslocamento de abomaso é uma doença economicamente importante na bovinocultura leiteira e é definido como uma síndrome multifatorial onde há basicamente duas possibilidades de deslocamento, na primeira, a víscera pode deslocar-se à esquerda, causando o deslocamento do abomaso à esquerda e a segunda possibilidade, o órgão pode mover-se totalmente para o lado direito, provocando o deslocamento do abomaso à direita, sendo que o primeiro ocorre mais frequentemente. O período de maior ocorrência do deslocamento do abomaso à esquerda, se insere imediatamente ou até seis semanas após o parto. Assim, objetivou-se com essa revisão sistemática, elucidar as principais causas e fatores de risco, os variados sinais clínicos e os diversos métodos diagnósticos dessa enfermidade. Conclui-se que, é de extrema importância conhecer desde a causa, até o diagnóstico do deslocamento do abomaso à esquerda, para que auxilie os médicos veterinários a identificarem o problema na propriedade, direcioná-lo a um tratamento adequado e tomar medidas preventivas, eliminando os fatores de risco e consequentemente diminuindo a incidência do problema.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Pós-graduação em Desenvolvimento Humano e Tecnologias - IBRC

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Pós-graduação em Medicina Veterinária - FMVZ

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)