Dna Extraction From Filter-paper Spots Of Vaginal Samples Collected After Sexual Violence.

To detect the presence of male DNA in vaginal samples collected from survivors of sexual violence and stored on filter paper. A pilot study was conducted to evaluate 10 vaginal samples spotted on sterile filter paper: 6 collected at random in April 2009 and 4 in October 2010. Time between sexual assault and sample collection was 4-48hours. After drying at room temperature, the samples were placed in a sterile envelope and stored for 2-3years until processing. DNA extraction was confirmed by polymerase chain reaction for human β-globin, and the presence of prostate-specific antigen (PSA) was quantified. The presence of the Y chromosome was detected using primers for sequences in the TSPY (Y7/Y8 and DYS14) and SRY genes. β-Globin was detected in all 10 samples, while 2 samples were positive for PSA. Half of the samples amplified the Y7/Y8 and DYS14 sequences of the TSPY gene and 30% amplified the SRY gene sequence of the Y chromosome. Four male samples and 1 female sample served as controls. Filter-paper spots stored for periods of up to 3years proved adequate for preserving genetic material from vaginal samples collected following sexual violence.

Detection of the TLR4 1196C > T Polymorphism by Mismatched-Polymerase Chain Reaction Using Plasmid DNA as Internal Control in Restriction Fragment Length Polymorphism Assays

Background: Restriction fragment length polymorphism (RFLP) is a common molecular assay used for genotyping, and it requires validated quality control procedures to prevent mistyping caused by impaired endonuclease activity. We have evaluated the usefulness of a plasmid-based internal control in RFLP assays. Results: Blood samples were collected from 102 individuals with acute myocardial infarction (AMI) and 108 non-AMI individuals (controls) for DNA extraction and laboratory analyses. The 1196C> T polymorphism in the toll-like receptor 4 (TLR4) gene was amplified by mismatched-polymerase chain reaction (PCR). Amplicons and pBluescript II SK-plasmid were simultaneously digested with endonuclease HincII. Fragments were separated on 2% agarose gels. Plasmid was completely digested using up to 55.2 nmL/L DNA solutions and 1 mu L PCR product. Nevertheless, plasmid DNA with 41.4 nM or higher concentrations was incompletely digested in the presence of 7 mL PCR product. In standardized conditions, TLR4 1196C> T variant was accurately genotyped. TLR4 1196T allele frequency was similar between AMI (3.1%) and controls (2.0%, p = 0.948). TLR4 SNP was not associated with AMI in this sample population. In conclusion, the plasmid-based control is a useful approach to prevent mistyping in RFLP assays, and it is validate for genetic association studies such as TLR4 1196C> T.

Gene and genotypic diversity of Phytophthora cinnamomi in South Africa and Australia revealed by DNA polymorphisms

Phytophthora cinnamomi isolates from South Africa and Australia were compared to assess genetic differentiation between the two populations. These two populations were analysed for levels of phenotypic diversity using random amplified polymorphic DNAs (RAPDs) and gene and genotypic diversity using restriction fragment length polymorphisms (RFLPs). Sixteen RAPD markers from four decanucleotide Operon primers and 34 RFLP alleles from 15 putative loci were used. A few isolates from Papua New Guinea known to posses alleles different from Australian isolates were also included for comparative purposes. South African and Australian P. cinnamomi populations were almost identical with an extremely low level of genetic distance between them (D-m = 0.003). Common features for the two populations include shared alleles, low levels of phenotypic/genotypic diversity, high clonality, and low observed and expected levels of heterozygosity. Furthermore, relatively high levels of genetic differentiation between mating type populations (D-m South Africa = 0.020 and D-m Australia = 0.025 respectively), negative fixation indices, and significant deviations from Hardy-Weinberg equilibrium, all provided evidence for the lack of frequent sexual reproduction in both populations. The data strongly suggest that both the South African and Australian P. cinnamomi populations are introduced.

EDD, the human orthologue of the hyperplastic discs tumour suppressor gene, is amplified and overexpressed in cancer

EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

SOX2 is an amplified lineage-survival oncogene in lung and esophageal squamous cell carcinomas

Lineage-survival oncogenes are activated by somatic DNA alterations in cancers arising from the cell lineages in which these genes play a role in normal development(1,2). Here we show that a peak of genomic amplification on chromosome 3q26.33 found in squamous cell carcinomas (SCCs) of the lung and esophagus contains the transcription factor gene SOX2, which is mutated in hereditary human esophageal malformations(3), is necessary for normal esophageal squamous development(4), promotes differentiation and proliferation of basal tracheal cells(5) and cooperates in induction of pluripotent stem cells(6-8). SOX2 expression is required for proliferation and anchorage-independent growth of lung and esophageal cell lines, as shown by RNA interference experiments. Furthermore, ectopic expression of SOX2 here cooperated with FOXE1 or FGFR2 to transform immortalized tracheobronchial epithelial cells. SOX2-driven tumors show expression of markers of both squamous differentiation and pluripotency. These characteristics identify SOX2 as a lineage-survival oncogene in lung and esophageal SCC.

Indirect immune detection of ecdysone receptor (EcR) during the formation of DNA puffs in Bradysia hygida (Diptera, Sciaridae)

Gene amplification occurs in Bradysia hygida salivary glands, at the end of the fourth larval instar. The hormone 20-hydroxyecdysone (20E) triggers this process, which results in DNA puff formation. Amplified genes are activated in two distinct groups. The activity of the first group is dependent on high levels of 20E, while the second group needs low hormone levels. Consequently, the salivary glands of B. hygida constitute an interesting biological model to study how 20E, and its receptors, affect gene amplification and activity. We produced polyclonal antibodies against B. hygida EcR (BhEcR). In western blots a polypeptide of about 66 kDa was detected in salivary gland extracts. The antibodies were also used for indirect immune-localization of BhEcR in polytene chromosomes. RNA-polymerase II was also immune-detected. We did not detect the receptor in chromosome C where the first and second groups of DNA puffs form during DNA puff anlage formation, but it was present during puff expansion. During the active phase of both groups of DNA puffs, RNA polymerase II co-localized with BhEcR. After puff regression, these antigens were not detected. Apparently, EcR plays a direct role in the transcription of amplified genes, but its role in gene amplification remains enigmatic.

Genotyping of Brazilian Erysipelothrix spp. strains by amplified fragment length polymorphism

One hundred and fifty-one Erysipelothrix spp. isolates from diseased and carrier swine from Brazil were identified by PCR, submitted to serotyping and analyzed by amplified fragment length polymorphism with a single enzyme (AFLP). Reference strains from Australia and the United Kingdom were also examined. The 151 strains were classified into 18 different serotypes (1a, 1b, 2a, 2b, 4, 5, 6, 7, 8, 10, 11, 12, 15, 17, 19, 21, 24 and 25), being serotype 2b the most frequent (39.7%). By associating serotyping and PCR results, it was possible to identify 146 strains as E. rhusiopathiae and five strains as E. tonsillarum. Despite the fact that for this genus AFLP did not cluster all isolates according to serotype, origin, disease or isolation data, the execution of the technique was easy and fast, demonstrating high discriminatory power. The results produced by the AFLP analysis of Erysipelothrix spp. could also support its use as a discriminatory tool for E. rhusiopathiae and E. tonsillarum species. (C) 2010 Elsevier B.V. All rights reserved.

Differentiation of field isolates and vaccine strains of infectious laryngotracheitis virus by DNA sequencing

Two different regions of the infected cell protein 4 (ICP4) gene of infectious laryngotracheitis virus (ILTV) were amplified and sequenced for characterization of field isolates and tissue culture-origin (TCO) and chicken embryo-origin (CEO) vaccine strains. Phylogenetic analysis of the two regions showed differences in nucleotide and amino acid sequences between field isolates and attenuated vaccines. The PCR-RFLP results were identical to those obtained by DNA sequencing and validated their use to differentiate ILTV strains. The approach using the sequencing of the two fragments of the ICP4 gene showed to be an efficient and practical procedure to differentiate between field isolates and vaccine strains of ILTV. (C) 2009 Elsevier Ltd. All rights reserved.

DETECTION OF HTLV-I ANTIBODIES AND DNA IN BLOOD SAMPLE OF A PATIENT WITH MYELOPATHY IN NIGERIA

We describe a case of human T-lymphotropic virus type I associated myelopathy in a 50-year old woman in Nigeria. The patient presented with progressive loss of tone to the two lower limbs and later inability to walk. The HTLV-I antibody presence in the plasma collected from the patient was repeatedly detected by enzyme immunoassays (Abbott HTLV-I EIA and Coulter SELECT-HTLV I/II) and confirmed by Western blot technique. In addition, HTLV-I DNA was amplified from the genomic DNA isolated from the peripheral blood mononuclear cells of the patient by the polymerase chain reaction technique. This finding is significant being the first report of association of HTLV-I with myelopathy in Nigeria.

Detection of EBV-DNA in serum samples of an immunosuppressed child during a three years follow-up: association of clinical and PCR data with active infection

Twenty-four whole blood and serum samples were drawn from an eight year-old heart transplant child during a 36 months follow-up. EBV serology was positive for VCA-IgM and IgG, and negative for EBNA-IgG at the age of five years old when the child presented with signs and symptoms suggestive of acute infectious mononucleosis. After 14 months, serological parameters were: positive VCA-IgG, EBNA-IgG and negative VCA-IgM. This serological pattern has been maintained since then even during episodes suggestive of EBV reactivation. PCR amplified a specific DNA fragment from the EBV gp220 (detection limit of 100 viral copies). All twenty-four whole blood samples yielded positive results by PCR, while 12 out of 24 serum samples were positive. We aimed at analyzing whether detection of EBV-DNA in serum samples by PCR was associated with overt disease as stated by the need of antiviral treatment and hospitalization. Statistical analysis showed agreement between the two parameters evidenced by the Kappa test (value 0.750; p < 0.001). We concluded that detection of EBV-DNA in serum samples of immunosuppressed patients might be used as a laboratory marker of active EBV disease when a Real-Time PCR or another quantitative method is not available.

COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

SUMMARYThe use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ) in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

Chlamydia pneumoniae and atherosclerosis. Identification of bacterial DNA in the arterial wall

OBJECTIVE: The intracellular Gram-negative bacterium Chlamydia pneumoniae has been associated with atherosclerosis. The presence of Chlamydia pneumoniae has been investigated in fragments of the arterial wall with a technique for DNA identification. METHODS: Arterial fragments obtained from vascular surgical procedures in 58 patients were analyzed. From these patients, 39 were males and the mean age was 65±6 years. The polymerase chain reaction was used to identify the bacterial DNA with a pair of primers that codify the major outer membrane protein (MOMP) of Chlamydia pneumoniae. The amplified product was visualized by electrophoresis in the 2% agarose gel stained with ethidium bromide, and it was considered positive when migrating in the band of molecular weight of the positive controls. RESULTS: Seven (12%) out of the 58 patients showed positive results for Chlamydia pneumoniae. CONCLUSION: DNA from Chlamydia pneumoniae was identified in the arterial wall of a substantial number of patients with atherosclerosis. This association, which has already been described in other countries, corroborates the evidence favoring a role played by Chlamydia pneumoniae in atherogenesis.

DNA polymorphism of schistosomes and their snail hosts

Analysis of the genomes of schistosomes and one of their intermediate hosts, Biomphalaria glabrata, using Random Amplified Polymorphic DNA (RAPD) demonstrated that intraspecific genetic polymorphism in the parasite is limited but in the snail is highly pronounced. This suggests an important role for the snail in the determination of the epidemiology of the disease. In addition to their intraspecific stability, schistosome derived RAPDs exhibit a high level of interspecific polymorphism and are thus ideal for the construction of phylogenetic trees. For the detection of intraspecific polymorphisms extensive variation in the mitochondrial DNA is being exploited for the development of a PCR based test for Schistosoma mansoni. Gene level polymorphisms are being analyzed by Low Stringency Single Specific Primer PCR.