985 resultados para skin conductance response


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Activin is an important orchestrator of wound repair, but its potential role in skin carcinogenesis has not been addressed. Here we show using different types of genetically modified mice that enhanced levels of activin in the skin promote skin tumour formation and their malignant progression through induction of a pro-tumourigenic microenvironment. This includes accumulation of tumour-promoting Langerhans cells and regulatory T cells in the epidermis. Furthermore, activin inhibits proliferation of tumour-suppressive epidermal γδ T cells, resulting in their progressive loss during tumour promotion. An increase in activin expression was also found in human cutaneous basal and squamous cell carcinomas when compared with control tissue. These findings highlight the parallels between wound healing and cancer, and suggest inhibition of activin action as a promising strategy for the treatment of cancers overexpressing this factor.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients), and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients). Prevalence of bacteria isolated by culture methods was 90.9% (10/11). We cultured, from chiclero's ulcers (60%), pathogenic bacterial such as Staphylococcus aureus (20%), S. pyogenes (1.6%), Pseudomonas aeruginosa (1.6%), Morganella morganii (1.6%), and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%), Enterobacter spp. (20%), and Enterococcus spp. (20%). We also cultured coagulase-negative staphylococci in 40% (4/10) of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15) of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L.) mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

La peau est sujette à un vieillissement intrinsèque (processus naturel et chronologique) et extrinsèque (processus induit par l'environnement et notamment les rayons UV). Plusieurs études ont montré que le vieillissement cutané s'accompagne d'une réduction de la densité capillaire au sein du derme et d'une dégradation de plusieurs protéines de la matrice extracellulaire. Cette atteinte morphologique est associée à une diminution de la capacité vasodilatatrice maximale de la microcirculation dermique et en particulier, de la réponse maximale du flux sanguin cutané à un échauffement local de la surface cutanée à des températures avoisinant les 43-44°C. Cette réponse, appelée hyperémie locale induite par la chaleur (local thermal hyperemia), est facilement mesurable par des investigations non invasives, telles que le laser Doppler. Nous avons entrepris cette étude afin d'investiguer les effets de l'âge sur la réactivité de la microcirculation dermique dans des zones cutanées exposées différemment aux rayons UV. Pour ce faire, nous avons étudié, chez des patients jeunes (18 à 30 ans, n=13) et des patients âgés (> 60 ans, n=13), la vasodilatation cutanée induite par réchauffement local de la peau, au niveau de 3 sites anatomiques différents (la cuisse, l'avant- bras et le front). Les mesures ont été effectuées au moyen d'un laser Doppler. Pour chaque sujet et chaque site, la température cutanée fut tout d'abord amenée à 34°C par 2 corps de chauffe (A et B), disposés de manière adjacente sur la peau. La température fut ensuite augmentée à 39°C (corps de chauffe A) et à 41°C (corps de chauffe B) pour une durée de 30 minutes, dans l'optique d'induire une vasodilatation sous- maximale. Ensuite, la température fut augmentée à 43 °C (corps de chauffe A et B) pour 15 minutes supplémentaires. Enfin, la vasodilatation maximale a été induite par un échauffement local à 44°C pour 15 minutes supplémentaires (corps de chauffe A et B). L'enregistrement séquentiel du flux sanguin cutané, effectué chaque minute par laser Doppler imager, donne des images sur lesquelles peut être calculé le flux sanguin cutané (unités de perfusion, PU). Par la suite, nous avons calculé les conductances vasculaires cutanées (CVC), en divisant le flux sanguin (PU) par la tension artérielle moyenne (mmHg), afin de permettre une normalisation entre les différents sujets. Les CVC, évaluées au temps de départ (température 34°C) et après vasodilatation maximale (température 44°C), étaient plus hautes au niveau du front qu'au niveau des 2 autres sites anatomiques. Sur les 3 sites, la CVC maximale (température 44°C) diminuait avec l'âge mais de façon moins importante au niveau du front, en comparaison avec les 2 autres sites. La réponse aux températures sous-maximales (température 39 et 41°C), exprimée en pourcentage de la CVC maximale, ne variait pas avec l'âge ni en fonction du site anatomique étudié. En conclusion, cette étude est la première à étudier simultanément l'hyperémie locale induite par la chaleur sur 3 sites ayant une exposition différente aux rayons UV. Le processus utilisé (laser Doppler imager) est également unique dans la littérature concernant les altérations de la microcirculation cutanée en lien avec l'âge. Cette étude confirme ainsi que le vieillissement cutané intrinsèque et/ou extrinsèque réduit la capacité vasodilatatrice maximale de la microcirculation dermique. Par contre, la réactivité à réchauffement local à des températures moindres ne semble pas être affectée.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

RAPPORT DE SYNTHESE Introduction : dans la présente étude, nous nous sommes intéressés à la vasodilatation cutanée induite par le réchauffement local (hyperémie thermique). Il est établi, qu'une partie de cette réponse vasculaire est médiée par l'oxyde nitrique (NO). De manière générale, les effets du NO peuvent être sujets à une désensibilisation, comme nous le démontre le phénomène bien connu de tolérance aux dérivés nitrés. Le but du présent travail était d'évaluer si une telle désensibilisation existe dans le cas de l'hyperémie thermique. Méthodes : nous avons donc examiné si une première stimulation thermique pouvait en atténuer une deuxième, induite plus tard sur le même site cutané à une intervalle de 2h ou 4h. Pour vérifier directement l'effet du réchauffement local sur la sensibilité de la microcirculation cutanée au NO, nous avons de plus appliqué un donneur de NO (nitroprussiate de sodium, SNP) par la technique d' iontophorèse, sur des sites cutanés préalablement soumis à un échauffement local 2h ou 4h auparavant. Nous avons examinés 12 sujets en bonne santé habituelle, de sexe masculin, non fumeurs, âgés de 18 à 30 ans, ne prenant aucune médication. Le flux sanguin dermique a été mesuré par imagerie laser Doppler (LDI, Moor Instruments) sur la face antérieur de l'avant-bras. Le réchauffement local de la peau a été effectué grâce a des petits anneaux métalliques thermo-contrôlés contenant de l'eau. La température était initialement de 34°C. Elle a été augmentée à 41 °C en une minute et maintenue à cette valeur durant 30 minutes. Cette manoeuvre a été répétée sur le même site cutané soit 2 h, soit 4h plus tard. Quant à l'iontophorèse de SNP, elle a été effectuée sur des sites ayant préalablement subi, 2h ou 4h auparavant, un échauffement unique appliqué selon la technique qui vient d'être décrite. Résultats : nous avons observé une atténuation de l'hyperémie thermique lorsque celleci était examinée 2h après un premier échauffement local. Lorsque l'intervalle était de 4h la réponse vasodilatatrice n'était pas réduite. Nous avons également observé une atténuation de la réponse vasodilatatrice au SNP lorsque celui-ci a était appliqué 2h, mais non 4h après un premier échauffement local. Conclusion :cette étude démontre que la réponse vasodilatatrice cutanée induite par l'échauffement local est bien sujette à désensibilisation, comme nous en avions formulé l'hypothèse. Ce phénomène est transitoire. Il est lié, au moins en partie, à une baisse de sensibilité de la microcirculation cutanée aux effets vasodilatateurs du NO.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

BACKGROUND: In humans, local heating increases skin perfusion by mechanisms dependent on nitric oxide (NO). Because the vascular effects of NO may be subject to desensitization, we examined whether a first local thermal stimulus would attenuate the hyperemic response to a second one applied later. METHODS: Twelve healthy young men were studied. Skin blood flow (SkBF) was measured on forearm skin with laser Doppler imaging. Local thermal stimuli (temperature step from 34 to 41 degrees C maintained for 30 minutes) were applied with temperature-controlled chambers. We also tested the influence of prior local heating on the vasodilation induced by sodium nitroprusside (SNP), a donor of NO. RESULTS: On reheating the same spot after two hours, the response of SkBF (i.e., plateau SkBF at 30 minutes minus SkBF at 34 degrees C) was lower than during the first stimulation (mean+/-SD 404+/-212 perfusion units [PU] vs. 635+/-100 PU; P<0.001). There was no such difference when reheating after four hours (654+/-153 vs. 645+/-103 PU; P=NS). Two, but not four, hours after local heating, the response of SkBF to SNP was reduced. CONCLUSION: The NO-dependent hyperemic response induced by local heating in human skin is subject to desensitization. At least one part of the mechanism implicated consists of a desensitization to the effects of NO itself.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The transcription factor serum response factor (SRF) plays a crucial role in the development of several organs. However, its role in the skin has not been explored. Here, we show that keratinocytes in normal human and mouse skin expressed high levels of SRF but that SRF expression was strongly downregulated in the hyperproliferative epidermis of wounded and psoriatic skin. Keratinocyte-specific deletion within the mouse SRF locus during embryonic development caused edema and skin blistering, and all animals died in utero. Postnatal loss of mouse SRF in keratinocytes resulted in the development of psoriasis-like skin lesions. These lesions were characterized by inflammation, hyperproliferation, and abnormal differentiation of keratinocytes as well as by disruption of the actin cytoskeleton. Ultrastructural analysis revealed markedly reduced cell-cell and cell-matrix contacts and loss of cell compaction in all epidermal layers. siRNA-mediated knockdown of SRF in primary human keratinocytes revealed that the cytoskeletal abnormalities and adhesion defects were a direct consequence of the loss of SRF. In contrast, the hyperproliferation observed in vivo was an indirect effect that was most likely a consequence of the inflammation. These results reveal that loss of SRF disrupts epidermal homeostasis and strongly suggest its involvement in the pathogenesis of hyperproliferative skin diseases, including psoriasis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Previous studies in the lab of Dr. Liliane Michalik, have shown thai the nuclear hormone receptor Peroxisome Proliferator Activated Receptor beta/delta (PPARß/ö) is an important regulator of skin homeostasis, being involved in the regulation of keratinocyte differentiation, inflammation, apoptosis, arid mouse skin wound healing. Studies of PPARß/ö knock out mice have suggested a possible role for this receptor in cancer. However, contradictory observations of the role for PPARß/ö on tumor growth have been published, depending on cellular contexts and biological models. Given the controversial role of PPARß/ö in skin carcinoma development, the main aim of this PhD work has been to further explore the implication of PPARß/ö in skin response to UV and skin tumor growth. This PhD dissertation is divided in four chapters. The first chapter describes the core part of the project, where I explored the changes in miRNA expression in the skin upon chronic UV irradiation of PPARß/ö wild type and knock-out mice. This analysis shed light on a miRNA- PPARß/ö signature and also predicted thai miR-21-3p (previously named miR-21*) is a key regulator of the PPARß/ö-dependent UV response in the pre-lesiona! skin. Using mice acutely UV-irradiated, ! further demonstrated that miR-21-3p is indirectly regulated by PPARß/ö through activation of Transforming Growth Factor (TGFß)-1 under UV exposure. I also show that miR-21-3p is deregulated in human cutaneous squamous celi carcinoma. In cultured keratinocytes, application of a miR-21 -3p mimic oligonucleotide sequence leads to the regulation of lipid metabolism-related pathway. In the second chapter, I demonstrate that the usage of an mRNA/miRNA combined bioinformatics analysis leads to the discovery of important pathways involved in the PPARß/ö-miRNA response of the skin to chronic UV irradiation, indeed, I validated angiogenesis and lipid metabolism as important functions regulated by PPARß/ö in this context. In the third chapter, we demonstrate that PPARß/5 knockout mice have decreased cutaneous squamous cell carcinomas incidence compared to wild type mice and that PPARß/5 directly activates the cSrc kinase gene. In the last chapter, we review novel insights into PPAR functions in keratinocytes and liver, with emphasis on PPARß/ö but also on PPARa. In summary, this PhD study shows that i) PPARß/5 is able to regulate biological function through regulation of miRNAs, and specifically through miR-21-3p, the passenger miRNA of the oncomiR miR-21, and that ii) the PPARß/5-dependent skin response to UV involves the regulation of angiogenesis and lipid metabolism. Furthermore, the bioinformatics study highlights the relevance of performing integrated mRNA and miRNA genome-wide studies in order to better screen mRNAs and/or miRNAs of interest in the biological context of diseases. - Des études préalables dans le laboratoire du Dr. Liliane Michalik ont démontré que le récepteur nucléaire PPARß/5 est un régulateur important de l'homéostasie de la peau, étant impliqué dans la régulation de la différenciation des keratinocytes, dans l'inflammation, dans l'apoptose et dans la cicatrisation de la peau chez !a souris. L'étude de souris knock-out pour le gène PPARß/5, ont suggérées un rôle possible de ce récepteur dans le cancer. Cependant, des observations opposées ont été publiées suggérant un rôle pro- ou anti- cancer selon le tissue impliqué et le type- cellulaire. En considérant cette controverse autour du rôle de PPARß/5 dans le développement des cancers de la peau, le but principal de mon projet de recherche aura été d'approfondir l'exploration du rôle de PPARß/5 dans la réponse de la peau aux UVs et dans le développement du cancer. Cette dissertation de thèse est divisée en quatre parties. Une première partie, représentant le coeur de mon travail de recherche, décrit la découverte de l'implication des microRNAs (rniRNAs) dans la réponse aux UVs de PPARß/ö et plus spécifiquement l'implication du miRNA miR- 21 -3p (précédemment nommé miR-21*). En étudiant un modèle de souris irradiées de manière aigüe aux UVs, nous montrons que ia régulation de miR-21-3p est PPARß/ö-däpenaante et que cette régulation à lieu par l'intermédiaire du facteur de transcription TGFß-1. Dans des cultures de keratinocytes Humains, la transfecticn d'une séquence oligonucléotidique similaire à celle de miR-21-3p (mimic), montre l'implication de rniR-21-3p dans des fonctions importantes pour le développement des cancers telles que le métabolisme des lipides. Dans un second chapitre, nous montrons que l'usage d'une méthode bioinformatique combinant l'expression des ARN messagers et des miRNAs permet de mettre en évidence des fonctions biologiques importantes lors de ia réponse de PPARß/ö à l'irradiation chronique. L'angiogenèse, le stress oxydatif et le métabolisme des lipides font partie de ces fonctions régulées par PPARß/5 dans la peau irradiée aux UVs. Nous mettons également en évidence la régulation du gène LpcatS par PPARß/5 dans la peau irradiée aux UV ainsi que dans des keratinocytes humains suggérant un rôle pour PPARß/5 dans le remodelage des lipides membranaires. Dans une troisième partie, nous établissons un lien entre la régulation de l'oncogène Src et l'activation de PPARß/5 dans les carcinomes spinocellulaires de la peau. Finalement dans un quatrième chapitre, nous faisons une revue des dernières recherches portées sur le rôle de PPARß/5 et de PPARa dans le foie et ia peau. En résumé ce projet de thèse représente un avancement pour la recherche sur rimplication de PPARß/5 dans la réponse aux UVs de la peau. Pour la première fois, un lien est établi entre ce facteur de transcription et la régulation de microRNAs dans le cadre du carcinome spinocellulare. Jusqu'alors resté dans l'ombre de rniR-21-5p, miR-21-3p est en fait fortement augmenté à la fois dans un modèle de souris d'irradiation aux UVs ainsi que dans ie carcinome spinocellulare chez i'humain. De nouvelles fonctions biologiques pour PPARß/5 ont été également mises en évidence dans ce travail, comme la régulation de l'angiogenèse ou du métabolisme des lipides dans Sa peau. De plus cette dissertation valorise l'intérêt d'une association entre le travail de laboratoire et celui de la bioinformatique.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The relationship between the irritable bowel syndrome (IBS) and food intolerance is not clear. We studied the cutaneous response to food antigens in 43 volunteers who were students and employees of the Faculty of Medicine of Universidade Federal Fluminense. Subjects were divided into 3 groups after evaluation for Roma II criteria for functional disease of the gastrointestinal tract: group I, 14 volunteers with IBS; group II, 15 volunteers with functional dyspepsia; group III, 14 volunteers without habitual gastrointestinal symptoms. The subjects were submitted to the skin prick test with 9 food antigen extracts, for a total of 387 skin tests (9 per volunteer). Of the 126 tests applied to group I, 24 (19.4%) were positive (a 3-mm wider papule than the negative control) and of the 135 tests applied to group II, 3 (2.3%) were positive. Of the 126 tests applied to group III, 6 (4%) were positive. The number of positive responses obtained in group I (IBS) differed significantly from the other 2 groups (P < 0.01). None of the volunteers with IBS reported intolerance to any isolated food. The higher reactivity to food antigens in group I compared to groups II and III suggests that intestinal permeability may be increased in patients with IBS.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The long-term effects of low-level lead intoxication are not known. The sympathetic skin response (SSR) was evaluated in a group of 60 former workers of a primary lead smelter, located in Santo Amaro, BA, Brazil. The individuals participating in the study were submitted to a clinical-epidemiological evaluation including questions related to potential risk factors for intoxication, complaints related to peripheral nervous system (PNS) involvement, neurological clinical examination, and also to electromyography and nerve conduction studies and SSR evaluation. The sample consisted of 57 men and 3 women aged 34 to 69 years (mean ± SD: 46.8 ± 6.9). The neurophysiologic evaluation showed the presence of lumbosacral radiculopathy in one of the individuals (1.7%), axonal sensorimotor polyneuropathy in 2 (3.3%), and carpal tunnel syndrome in 6 (10%). SSR was abnormal or absent in 12 cases, representing 20% of the sample. More than half of the subjects (53.3%) reported a history of acute abdominal pain requiring hospitalization during the period of work at the plant. A history of acute palsy of radial and peroneal nerves was reported by about 16.7 and 8.3% of the individuals, respectively. Mean SSR amplitude did not differ significantly between patients presenting or not the various characteristics in the current neurological situation, except for diaphoresis. The results suggest that chronic lead intoxication induces PNS damage, particularly affecting unmyelinated small fibers. Further systematic study is needed to more precisely define the role of lead in inducing PNS injury.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Stings by Polistes wasps can cause life-threatening allergic reactions, pain and inflammation. We examined the changes in microvascular permeability and neutrophil influx caused by the venom of Polistes lanio a paper wasp found in southeastern Brazil. The intradermal injection of wasp venom caused long-lasting paw oedema and dose-dependently increased microvascular permeability in mouse dorsal skin. SR140333, an NK(1) receptor antagonist, markedly inhibited the response, but the NK(2) receptor antagonist SR48968 was ineffective. The oedema was reduced in capsaicin-treated rats, indicating a direct activation of sensory fibres. Dialysis of the venom partially reduced the oedema and the remaining response was further inhibited by SR140333. Mass spectrometric analysis of the venom revealed two peptides (QPPTPPEHRFPGLM and ASEPTALGLPRIFPGLM) with sequence similarities to the C-terminal region of tachykinin-like peptides found in Phoneutria nigniventer spider venom and vertebrates. Wasp venom failed to release histamine from mast cells in vitro and spectrofluorometric assay of the venom revealed a negligible content of histamine in the usual dose of P.l. lanio venom (1 nmol of histamine/7 mu g of venom)that was removed by dialysis. The histamine H(1) receptor antagonist pyrilamine, but not bradykinin B(1) or B(2) receptor antagonists, inhibited venom-induced oedema. In conclusion, P. l. lanio venom induces potent oedema and increases vascular permeability in mice, primarily through activation of tachykinin NK(1) receptors by substance P released from sensory C fibres, which in turn releases histamine from dermal mast cells. This is the first description of a neurovascular mechanism for P. l. lanio venom-mediated inflammation. The extent to which the two tachykinin-like peptides identified here contribute to this neurogenic inflammatory response remains to be elucidated. (c) 2008 Elsevier Ltd. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Objective: We investigated the influence of acute inflammation in skin isograft acceptance. Methods: Two mouse lines selected for maximal (AIR(MAX)) or minimal inflammatory response (AIR(MIN)) were transplanted with syngeneic skin. Cellular infiltrates and cytokine production were measured 1, 3, 7 or 14 days post-transplantation. The percentage of CD4(+) CD25(+) Foxp3(+) cells in the lymph nodes was also evaluated. Results: Grafts were totally accepted in 100% of AIR(MAX) and in 26% of AIR(MIN) mice. In the latter, partial acceptance was observed in 74% of the animals. Emigrated cells were basically PMN and were enhanced in AIR(MAX) transplants. IL-10 production by graft infiltrating cells showed no interline differences. IFN-gamma was increased in AIR(MIN) grafts at day 14 and lower percentages of CD4(+)CD25(+)Foxp3(+) cells in the lymph nodes were observed in these mice. Conclusions: Our data suggest that differences in graft acceptance might be due to a lack of appropriate regulation of the inflammatory response in AIR(MIN) mice compromising the self/non-self recognition.