Valuing water resources in developing countries: A semiparametric approach to valuation models

Valuation of projects for the preservation of water resources provides important information to policy makers and funding institutions. Standard contingent valuation models rely on distributional assumptions to provide welfare measures. Deviations from assumed and actual distribution of benefits are important when designing policies in developing countries, where inequality is a concern. This article applies semiparametric methods to obtain estimates of the benefit from a project for the preservation of an important Brazilian river basin. These estimates lead to significant differences from those obtained using the standard parametric approach.

Dermaseptin 01 as antimicrobial peptide with rich biotechnological potential: study of peptide interaction with membranes containing Leishmania amazonensis lipid-rich extract and membrane models

This article addresses the interactions of the synthetic antimicrobial peptide dermaseptin 01 (GLWSTIKQKGKEAAIAAA-KAAGQAALGAL-NH(2), DS 01) with phospholipid (PL) monolayers comprising (i) a lipid-rich extract of Leishmania amazonensis (LRE-La), (ii) zwitterionic PL (dipalmitoylphosphatidylcholine, DPPC), and (iii) negatively charged PL (dipalmitoylphosphatidylglycerol, DPPG). The degree of interaction of DS 01 with the different biomembrane models was quantified from equilibrium and dynamic liquid-air interface parameters. At low peptide concentrations, interactions between DS 01 and zwitterionic PL, as well as with the LRE-La monolayers were very weak, whereas with negatively charged PLs the interactions were stronger. For peptide concentrations above 1 mu g/ml, a considerable expansion of negatively charged monolayers occurred. In the case of DPPC, it was possible to return to the original lipid area in the condensed phase, suggesting that the peptide was expelled from the monolayer. However, in the case of DPPG, the average area per lipid molecule in the presence of DS 01 was higher than pure PLs even at high surface pressures, suggesting that at least part of DS 01 remained incorporated in the monolayer. For the LRE-La monolayers, DS 01 also remained in the monolayer. This is the first report on the antiparasitic activity of AMPs using Langmuir monolayers of a natural lipid extract from L. amazonensis. Copyright (C) 2011 European Peptide Society and John Wiley & Sons, Ltd.

A Delphi study of district nursing research priorities in Australia

This study, using a Delphi approach, sought the opinion of a self-selected panel of 320 district nurses regarding research priorities for district nursing in Australia. Over three rounds of questionnaires, the 419 research clinical problem areas requiring research as suggested by the panel were each rated in importance by the panel and then ranked through analysis from high to low average rating scores, thereby, whittling down the list to the top 15% (68) research questions and to a final list of the top 10 research priorities overall. Research questions focusing on discharge planning are dominant in these top 10 priorities, with documentation issues the second most common focus. Other foci in the top 10 priorities are staffing, aged care, palliative care, and assessment. The organization-specific top 10 research priorities focus on wound care, funding, education, and communication issues. Additionally, the top 68 priorities, which are either finitely practice-based or contextual-issues research questions, were categorized into 20 themes. The results will hopefully lead to scarce human and financial resources being directed to practice-relevant research programs that will facilitate improved health for district nursing (primarily home-nursing) clients in Australia and elsewhere. (c) 2005 Elsevier Inc. All rights reserved.

MINERALOGY AND GENESIS OF SMECTITES IN AN ALKALINE-SALINE ENVIRONMENT OF PANTANAL WETLAND, BRAZIL

Smectite formation in alkaline-saline environments has been attributed to direct precipitation from solution and/or transformation from precursor minerals, but these mechanisms are not universally agreed upon in the literature. The objective of this work was to investigate the mineralogy of smectites in the soils surrounding a representative alkaline-saline lake of Nhecolandia, a sub-region of the Pantanal wetland, Brazil, and then to identify the mechanisms of their formation. Soils were sampled along a toposequence and analyzed by X-ray diffraction, transmission electron microscopy-energy dispersive X-ray analysis, and inductively coupled plasma-mass spectrometry. Water was collected along a transect involving the studied toposequence and equilibrium diagrams were calculated using the databases PHREEQC and AQUA. The fine-clay fraction is dominated by smectite, mica, and kaolinite. Smectites are concentrated at two places in the toposequence: an upper zone, which includes the soil horizons rarely reached by the lake-level variation; and a lower zone, which includes the surface horizon within the area of seasonal lake-level variation. Within the upper zone, the smectite is dioctahedral, rich in Al and Fe, and is classified as ferribeidellite. This phase is interstratified with mica and vermiculite and has an Fe content similar to that of the mica identified. These characteristics suggest that the ferribeidellite originates from transformation of micas and that vermiculite is an intermediate phase in this transformation. Within the lower zone, smectites are dominantly trioctahedral, Mg-rich, and are saponitic and stevensitic minerals. In addition, samples enriched in these minerals have much smaller rare-earth element (REE) contents than other soil samples. The water chemistry shows a geochemical control of Mg and saturation with respect to Mg-smectites in the more saline waters. The REE contents, water chemistry, and the presence of Mg-smectite where maximum evaporation is expected, suggest that saponitic and stevensitic minerals originate by chemical precipitation from the water column of the alkaline-saline lake.

RACE, RESOURCES, AND POLITICAL PARTICIPATION IN A BRAZILIAN CITY

Does race influence political behavior in Brazil? Using data from Belo Horizonte, Brazil, we explore whether an individual`s propensity to take part in a political association is affected by race, independent of socioeconomic position and of the availability of resources derived from this position. We found that white individuals participate more in political associations than do black individuals; however, after taking into account the differences in all types of resources, we found no difference in participation by racial groups. Nevertheless, by interacting race, skills, and income, it turns out that different racial groups use the same resources differently. A white individual`s propensity to participate politically is significantly more affected by income than a similar black individual`s propensity. Therefore, we argue that race mediates the effect of resources on political participation, which means that either different groups may use different resources or different groups can differ in how intensively they use resources.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Development of a synthetic 7-ketocholesterol- rich emulsion resembling chylomicrons

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

A semi-empirical approach to optimise the quantity of drying aids required to spray dry sugar-rich foods

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.

Metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein in young obese and normal-weight patients with polycystic ovary syndrome

Objective: To clarify whether the metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein (HDL) are altered in patients with polycystic ovary syndrome (PCOS). Design: Case control study. Setting: Endocrinology clinics. Patient(s): Eight normal-weight (NW) and 15 obese (013) patients with PCOS were compared with 10 NW and 10 Ob women without PCOS paired for age and body mass index. Intervention(s): Determination of triglyceride-rich lipoprotein metabolism and lipid transfer to HDL. Main Outcome Measure(s): Participants were injected triglyceride-rich emulsions labeled with (14)C-cholesteryl esters and (3)H-triglycerides and the fractional clearance rate (FCR, in min(-1)) of labels was determined. Lipid transfer from artificial nanoemulsions to HDL was performed by incubating radioactively labeled lipid nanoemulsions with plasma during 1 hour, followed by radioactive counting of HDL-containing supernatant after chemical precipitation. Result(s): Lipolysis estimated by triglyceride FCR was equal in PCOS groups (NW = 0.043 +/- 0.032, Ob = 0.033 +/- 0.009) and respective controls (NW = 0.039 +/- 0.015, Ob = 0.044 +/- 0.019). However, the remnant removal as estimated by cholesteryl ester FCR was reduced in both PCOS groups (NW = 0.005 +/- 0.006, Ob = 0.005 +/- 0.005) compared with controls (NW = 0.016 +/- 0.006, Ob = 0.011 +/- 0.072). Lipid transfer rates were not different among groups, but triglyceride transfer rates were positively correlated with homeostasis model assessment estimate of insulin resistance in PCOS. Conclusion(s): PCOS patients showed decreased removal of atherogenic remnants even when fasting glucose was <100 mg/dL. This reinforces the usefulness of the measures taken to prevent cardiovascular events in PCOS patients. (Fertil Steril (R) 2010;93:1948-56. (C)2010 by American Society for Reproductive Medicine.)