Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Implementación de un método cuantitativo para la detección del virus Psorosis de cítricos mediante RT-PCR tiempo real y su evaluación en muestras de campo

Tesis (Doctora en Ciencias con Especialidad en Biotecnología) U.A.N.L. Facultad de Ciencias Biológicas, 2007.

Simple and surprisingly effective one-step extraction-cleanup by Soxflo for DDT and its metabolites from environmental samples

A pilot study found that DDT breakdown at the GC inlet was extensive in extracts from some-but not all-samples with high organic carbon contents. However, DDT losses could be prevented with a one-step extraction-cleanup in the Soxflo instrument with dichloromethane and charcoal. This dry-column procedure took 1 h at room temperature. It was tested on spiked soil and peat samples and validated with certified soil and sediment reference materials. Spike recoveries from freshly spiked samples ranged from 79 to 111% at 20-4000 mug/kg concentrations. Recoveries from the real-world CRMs were 99.7-100.2% of DDT, 89.7-90.4% of DDD and 89.6-107.9% of DDE. It was concluded that charcoal cleanups should be used routinely during surveys for environmental DDX pollution in order to mitigate against unpredictable matrix-enhanced breakdown in the GC. (C) 2004 Elsevier B.V. All rights reserved.

A facile one step synthesis of N-2 substituted 3-phenyliminoisoindolinones from N-(2-carboxybenzoyl)-anthranilic acid and the design of reverse-turn mimetics

Stirring of N-(2-carboxybenzoyl) anthranilic acid with anilines and amines such as p-toluidine, benzylamine, methyl esters of Leu, Phe, Ile and Val in presence of DCC produces N- 2 substituted 3-phenyliminoisoindolinones in very good yields. Single crystal X-ray diffraction studies and solution phase NMR and CD studies reveal that the 3-phenyliminoisoindolinone moiety is a turn-inducing scaffold which should be useful for reverse-turn mimetics.

One-step catalytic cyclohexane oxidation to adipic acid using molecular oxygen

Using combination of Mn-Co transition metal species with N-hydroxyphthalimide as a catalyst for one-step oxidation of cyclohexane with molecular oxygen in acetic acid at 353 K can give more than 95% selectivity towards oxygenated products with adipic acid as a major product at a high conversion (ca. 78%). A turnover number of 74 for this partial oxidation are also recorded.

A stable one-step-ahead predictive control of non-linear systems

In this paper stability of one-step ahead predictive controllers based on non-linear models is established. It is shown that, under conditions which can be fulfilled by most industrial plants, the closed-loop system is robustly stable in the presence of plant uncertainties and input–output constraints. There is no requirement that the plant should be open-loop stable and the analysis is valid for general forms of non-linear system representation including the case out when the problem is constraint-free. The effectiveness of controllers designed according to the algorithm analyzed in this paper is demonstrated on a recognized benchmark problem and on a simulation of a continuous-stirred tank reactor (CSTR). In both examples a radial basis function neural network is employed as the non-linear system model.

Otimização da RT-PCR Multiplex para detecção de vírus dengue em amostras de Aedes aegypti infectados artificialmente

A dengue é a mais importante doença viral transmitida por mosquitos, no que diz respeito à morbidade e mortalidade, que afeta os seres humanos. Este vírus é transmitido pelos vetores Aedes albopictus e Aedes aegypti, este último é o principal vetor nas Américas. O controle da doença se baseia na vigilância laboratorial e vigilância entomológica. A vigilância laboratorial visa aprimorar a capacidade do diagnóstico, detectando precocemente a circulação viral e monitorando os sorotipos circulantes. Dentro deste tipo de vigilância, a RT-PCR é um método bastante usado no diagnóstico da doença em humanos e mosquitos, porém, a má conservação do material pode comprometer a integridade do RNA e trazer resultados falso-negativos. O desenvolvimento de melhores métodos de vigilância do vírus dengue (DENV) em mosquitos é de grande valor para os programas de controle. Desta maneira, o presente projeto visou otimizar a técnica de RT-PCR Multiplex para detecção de DENV em amostras de Ae. aegypti infectadas artificialmente pelo vírus. Primers que amplificam uma região de 80 pb do gene rpL8 de mosquito foram desenhados no site Primer3 e avaliados na ferramenta online Multiple Primer Analyzer, junto com primers que amplificam os sorotipos DENV. Não houve competição de primers e foi observado bandas distintas no gel de agarose. Foi avaliado o efeito de diferentes formas de preservação do material genético das amostras (RNAlater®, freezer -80°C e nitrogênio líquido) por 7 dias, onde não houve diferenças significativas em relação à integridade do RNA. O efeito de diferentes formas de extração de RNA (Kit da QIAGEN® , TRIzol® e Chomczymski-Sacchi) também foi avaliado e o método ChomczymskiSacchi obteve o melhor desempenho. A otimização desta técnica permitirá uma maior confiabilidade nos resultados, já que além da detecção dos sorotipos, haverá uma confirmação da qualidade do RNA, aprimorando a capacidade do diagnóstico e auxiliando a prevenção e controle da transmissão da dengue.

One step forward, and two steps back: women and career progression in academia during times of uncertainty

While there is an extensive and still growing body of literature on women in academia and the challenges they encounter in career progression, there is little research on their experience specifically within a business school setting. In this study, we attempt to address this gap and examine the experiences and career development of female academics in a business school and how these are impacted by downsizing programmes. To this end, an exploratory case study is conducted. The findings of this study show that female business school academics experience numerous challenges in terms of promotion and development, networking, and the multiple and conflicting demands placed upon them. As a result, the lack of visibility seems to be a pertinent issue in terms of their career progression. Our data also demonstrates that that, paradoxically, during periods of downsizing women become more visible and thus vulnerable to layoffs as a consequence of the challenges and pressures created in their environment during this process. In this paper, we argue that this heightened visibility, and being subject to possible layoffs, further reproduces inequality regimes in academia.

Evaluation of Quantitative RT-PCR Using Nonamplified and Amplified RNA

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is a standard assay in molecular medicine for gene expression analysis. Samples from incisional/needle biopsies, laser-microdissected tumor cells and other biologic sources, normally available in clinical cancer studies, generate very small amounts of RNA that are restrictive for expression analysis. As a consequence, an RNA amplification procedure is required to assess the gene expression levels of such sample types. The reproducibility and accuracy of relative gene expression data produced by sensitive methodology as qRT-PCR when cDNA converted from amplified (A) RNA is used as template has not yet been properly addressed. In this study, to properly evaluate this issue, we performed 1 round of linear RNA amplification in 2 breast cell lines (C5.2 and HB4a) and assessed the relative expression of 34 genes using cDNA converted from both nonamplified (NA) and A RNA. Relative gene expression was obtained from beta actin or glyceraldehyde 3-phosphate dehydrogenase normalized data using different dilutions of cDNA, wherein the variability and fold-change differences in the expression of the 2 methods were compared. Our data showed that 1 round of linear RNA amplification, even with suboptimal-quality RNA, is appropriate to generate reproducible and high-fidelity qRT-PCR relative expression data that have similar confidence levels as those from NA samples. The use of cDNA that is converted from both A and NA RNA in a single qRT-PCR experiment clearly creates bias in relative gene expression data.

Caracterização parcial de um fragmento e detecção por RT-PCR de Rice Stripe Necrosis Virus

O enrolamento do arroz é uma doença viral emergente no Brasil causada pelo Rice stripe necrosis virus (RSNV) que é transmitido pelo protozoário Polymyxa graminis. RSNV é um membro do gênero Benyvirus com genoma dividido em 4 RNAs de fita simples no sentido positivo (ssRNA +). Em função da falta de conhecimento sobre a seqüência de nucleotídeos do seu genoma, a detecção de RSNV através de métodos moleculares não é utilizada. O objetivo deste trabalho foi identificar seqüências do genoma de RSNV que possibilitassem sua detecção em plantas de arroz através da técnica de transcrição reversa seguida da reação em cadeia da polimerase (RT-PCR). As seqüências do genoma foram identificadas a partir de clones de uma biblioteca de cDNAs obtidos de uma amostra do vírus parcialmente purificado. Os clones que hibridizaram com sondas sintetizadas a partir de RNA de plantas infectadas com RSNV foram seqüenciados e comparados às seqüências do GenBank. Um fragmento de 957 nt da extremidade 3’ da fita de um dos 4 RNAs genômicos de RSNV foi obtido. A análise da seqüência nucleotídeos desse fragmento não revelou qualquer similaridade com seqüências conhecidas, tampouco indicou uma possível função. Um par de oligonucleotídeos iniciadores foi desenhado a partir de um clone que potencialmente contém uma seqüência de RSNV. A especificidade e a sensibilidade da RT-PCR utilizando esse par de oligonucleotídeos iniciadores, bem como sua eficiência na detecção do vírus em diferentes partes da planta de arroz, foram avaliadas. Os resultados indicam que a RT-PCR é específica para RSNV e pode detectar o vírus em tecido oriundo das raízes, do colo e de folhas com distorção. Comparada ao diagnóstico da doença através da observação de sintomas e de estruturas do vetor, a RT-PCR é uma ferramenta confiável para a diagnose do enrolamento do arroz.

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

The heminested RT-PCR for the study of rabies virus pathogenesis

The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.