972 resultados para math.RT
Resumo:
A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.
Resumo:
Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Web services are loosely coupled applications that use XML documents as a way of integrating distinct systems on the internet. Such documents are used by in standards such as SOAP, WSDL and UDDI which establish, respectively, integrated patterns for the representation of messages, description, and publication of services, thus facilitating the interoperability between heterogeneous systems. Often one single service does not meet the users needs, therefore new systems can be designed from the composition of two or more services. This which is the design goal behind the of the Service Oriented Architecture. Parallel to this scenario, we have the PEWS (Predicate Path-Expressions for Web Services) language, which speci es behavioural speci cations of composite web service interfaces.. The development of the PEWS language is divided into two parts: front-end and back-end. From a PEWS program, the front-end performs the lexical analysis, syntactic and semantic compositions and nally generate XML code. The function of the back-end is to execute the composition PEWS. This master's dissertation work aims to: (i) reformulate the proposed architecture for the runtime system of the language, (ii) Implement the back-end for PEWS by using .NET Framework tools to execute PEWS programs using the Windows Work ow Foundation
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The RT of domestic quail from Italian variety showed mainly an albuginic pattern being represented by tortuous channels lined predominately by a simple cubic epithelium. RT channels extended along the testicular albuginea and penetrates into the epididymal region (ER) through its myoconnective matrix. Passageways were continuous to proximal efferent ducts of the ER. Epithelium lining ultrastructure of RT passageways showed some differences between the spring and the inactive phase at middle fall, concerning the quail testicular reproductive cycle. The features observed in RT epitheliocytes in fall were the low cytoplasmic electrodensity, paucity of supranuclear vesicles, which were abundant and variable in form and shape in spring, and some degenerative aspects of cell organelles mainly in ER lamellae. Moreover, presence of apical cytoplasmic extrusions were verified in the fall. No marked features were seen in the RT ultrastructure during the winter and summer comparatively to the active phase of spring.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Heart failure (NF) is frequently associated with euthyroid sicksyndrome (low T-3 and elevated rT(3)). We investigated if altered thyroid hormone in HF could affect expression of the TH receptor (TR alpha 1), and alpha and beta myosin heavy chains (alpha-MHC beta-MHC). HF was provoked in rats by aortic stenosis. We showed that rT(3) generated front liver and kidney deiodination significantly increased and T-3 decreased in HE; there was significantly higher TR alpha 1 expression, no alpha-MHC expression, but beta-MHC expression. Changes in TR alpha 1 could be compensating for low T-3 from HF.
Resumo:
Nowadays, networks must support applications such as: distance learning, electronic commerce, access to Internet, Intranets and Extranets, voice over IP (Internet Protocol) and many others. These new applications, employing data, voice, and video traffic, require high bandwidth and Quality of Service (QoS). The ATM (Asynchronous Transfer Mode) technology, together with dynamic resource allocation methods, offers network connections that guarantee QoS parameters, such as minimum losses and delays. This paper presents a system that uses Network Management Functions together with dynamic resource allocation for provision of the end-to-end QoS parameters for rt-VBR connections.