Sélection de gènes de référence pour la normalisation des expériences de PCR quantitative dans un modèle de dysfonction diastolique de lapin

La dysfonction diastolique du ventricule gauche (DDVG) réfère à une rigidité ainsi qu’à des troubles de relaxation au niveau de ce ventricule pendant la phase de la diastole. Nos connaissances sur les mécanismes moléculaires sous-jacents de cette pathologie demeurent limités. Les analyses géniques sont indispensables afin de bien identifier les voies par lesquelles cette maladie progresse. Plusieurs techniques de quantification de l’expression génique sont disponibles, par contre la RT-qPCR demeure la méthode la plus populaire vu sa haute sensibilité et de ses coûts modérés. Puisque la normalisation occupe un aspect très important dans les expériences de RT-qPCR, nous avons décidé de sélectionner des gènes montrant une haute stabilité d’expression dans un modèle de DDVG de lapin. Nous avons alors exposé 18 lapins blancs soit à une diète normale (n=7) ou bien à une diète hypercholestérolémiante additionnée de vitamine D2 (n=11). La DDVG a été évaluée par des mesures échocardiographiques. L’expression de l’ARNm de dix gènes communément utilisés dans la littérature comme normalisateur (Gapdh, Hprt1, Ppia, Sdha, Rpl5, Actb, Eef1e1, Ywhaz, Pgk1, et G6pd) a été mesurée par RT-qPCR. L’évaluation de leur stabilité a été vérifiée par les algorithmes de geNorm et Normfinder. Sdha et Gapdh ont obtenu les meilleurs scores de stabilité (M<0.2) et ont été suggérés par le geNorm, comme meilleure combinaison. Par contre, l’utilisation de Normfinder mène à la sélection d’Hprt1 et Rpl5 comme meilleure combinaison de gènes de normalisation (0.042). En normalisant par ces deux combinaisons de gènes, l’expression de l’ARNm des peptides natriurétiques de type A et B (Anp et Bnp), de la protéine chimiotactique des monocytes-1 (Mcp-1) et de la sous unité Nox-2 de la NADPH oxydase ont montré des augmentations similaires chez le groupe hypercholestérolémique comparé au groupe contrôle (p<0.05). Cette augmentation d’expressions a été corrélée avec plusieurs paramètres échocardiographiques de DDVG. À notre connaissance, c’est la première étude par laquelle une sélection de gènes de référence a été réalisée dans un modèle de lapin développant une DDVG.

Dopamine Receptor Subtypes,IP3, cAMP and cGMP Functional Regulation in Parkinsonism Induced by Unilateral Infusion of Rotenone in Rats: Recovery with Bone Marrow Cells,Serotonin and GABA Supplementation

In the present study, the effects of 5-HT, GABA and Bone Marrow Cells infused intranigrally to substantia nigra individually and in combinations on unilateral rotenone infused Parkinsonism induced rats. Scatchard analysis of DA, DA D1 and D2 receptors in the corpus striatum, cerebral cortex, cerebellum, brain stem and hippocampus showed a significant increase in the Brain regions of rotenone infused rat compared to control. Real Time PCR amplification of DA D1, D2, Bax and ubiquitin carboxy-terminal hydrolase were up regulated in the brain regions of rotenone infused rats compared to control. Gene expression studies of -Synuclien, cGMP and Cyclic AMP response element-binding protein showed a significant down regulation in Rotenone infused rats compared to control. Behavioural studies were carried out to confirm the biochemical and molecular studies.Our study demonstrated that BMC administration alone cannot reverse the above said molecular changes occurring in PD rat. 5-HT and GABA acting through their specific receptors in combination with bone marrow cells play a crucial role in the functional recovery of PD rats. 5-HT, GABA and Bone marrow cells treated PD rats showed significant reversal to control in DA receptor binding and gene expression. 5-HT and GABA have co-mitogenic property. Proliferation and differentiation of cells re-establishing the connections in Parkinson's disease facilitates the functional recovery. Thus, it is evident that 5-HT and GABA along with BMC to rotenone infused rats renders protection against oxidative, related motor and cognitive deficits which makes them clinically significant for cellbased therapy. The BMC transformed to neurons when co-transplanted with 5-HT and GABA which was confirmed with PKH2GL and nestin. These newly formed neurons have functional significance in the therapeutic recovery of Parkinson’s disease.

Serotonin receptor subtypes functional regulation and oxidative stress mediated apoptosis in 6-hydroxydopamine lesioned Parkinsonian rats

Parkinson’s disease is a chronic progressive neurodegenerative disorder characterized by the selective loss of dopaminergic neurons in the SNpc resulting in severe motor impairments. Serotonergic system plays an important regulatory role in the pathophysiology of PD in rats, the evaluation of which provides valuable insight on the underlying mechanisms of motor, cognitive and memory deficits in PD. We observed a decrease in 5-HT content in the brain regions of 6-OHDA infused rat compared to control. The decreased 5-HT content resulted in a decrease of total 5-HT, 5-HT2A receptors and 5-HTT function and an increase of 5-HT2C receptor function. 5-HT receptor subtypes - 5-HT2A and 5-HT2C receptors have differential regulatory role on the modulation of DA neurotransmission in different brain regions during PD. Our observation of impaired serotonergic neurotransmission in SNpc, corpus striatum, cerebral cortex, hippocampus, cerebellum and brain stem demonstrate that although PD primarily results from neurodegeneration in the SNpc, the associated neurochemical changes in other areas of the brain significantly contributes to the different motor and non motor symptoms of PD. The antioxidant enzymes – SOD, CAT and GPx showed significant down regulation which indicates increased oxidative damage resulting in neurodegeneration. We also observed an increase in the level of lipid peroxidation. Reduced expression of anti-apoptotic Akt and enhanced expression of NF-B resulting from oxidative stress caused an activation of caspase-8 thus leading the cells to neurodegeneration by apoptosis. BMC administration in combination with 5-HT and GABA to PD rats showed reversal of the impaired serotonergic neurotransmission and oxidative stress mediated apoptosis. The transplanted BMC expressed NeuN confirming that 5-HT and GABA induced the differentiation and proliferation of BMC to neurons in the SNpc along with an increase in DA content and an enhanced expression of TH. Neurotrophic factors – BDNF and GDNF rendered neuroprotective effects accompanied by improvement in behavioural deficits indicating a significant reversal of altered dopaminergic and serotonergic neurotransmission in PD. The restorative and neuroprotective effects of BMC in combination with 5-HT and GABA are of immense therapeutic significance in the clinical management of PD.

Glutamatergic Nmda And Ampa Receptors Functional Regulation In Streptozotocin Induced Diabetic Rats: Effect Of Vitamin D3 And Curcumin Supplementation

The present study was designed to investigate the protective effect of curcumin and vitamin D3 in the functional regulation of glutamatergic NMDA and AMPA receptors in streptozotocin (STZ) induced diabetic rats. Alterations in glutamatergic neurotransmission in the brain were evaluated by analyzing the glutamate content, glutamate receptors - NMDA and AMPA receptors binding parameters and gene expression, GAD and GLAST gene expression. Immunohistochemistry studies using confocal microscope were carried out to confirm receptor density and gene expression results of NMDA and AMPA receptors. The role of glutamatergic receptors in pancreas was studied using the following parameters; glutamate content, GLAST expression, glutamate receptors - NMDA and AMPA receptor binding and gene expression. Increasing evidence in both experimental and clinical studies suggests that oxidative stress plays a major role in the pathogenesis of diabetes. In the present study SOD assay and GPx gene expression were done to evaluate the activity of antioxidant enzymes in the brain regions and pancreas. NeuroD1 and Pdx1 gene expression were performed in pancreas of experimental rats to evaluate pancreatic islet survival. Gene expression profiles of caspase 8, Bax, and Akt in brain regions and pancreas were studied to understand the possible mechanism behind curcumin and vitamin D3 mediated neuroprotection and islet survival. Gene expression studies of vitamin D3 receptor localisation in the pancreas was done to understand the mechanism of vitamin D3 in insulin secretion. Curcumin and vitamin D3 mediated insulin secretion via Ca2+ release were studied using confocal microscope.

Anti-lipopolysaccharide factor and crustin-III, the anti-white spot virus peptides in Penaeus monodon: Control of viral infection by up-regulation

White Spot Syndrome Virus (WSSV) is the most devastating disease affecting shrimp culture around the world. Though, considerable progress has been made in the detection and molecular characterization of WSSV in recent years, information pertaining to immune gene expression in shrimps with respect to WSSV infection remains limited. In this context, the present study was undertaken to understand the differential expression of antimicrobial peptide (AMP) genes in the haemocytes of Penaeus monodon in response to WSSV infection on a time-course basis employing semi-quantitative RT-PCR. The present work analyzes the expression profile of six AMP genes (ALF, crustin-1, crustin-2, crustin-3, penaeidin-3 and penaeidin-5), eight WSSV genes (DNA polymerase, endonuclease, immediate early gene, latency related gene, protein kinase, ribonucleotide reductase, thymidine kinase and VP28) and three control genes (18S rRNA, β-actin and ELF) in P. monodon in response to WSSV challenge. Penaeidins were found to be up-regulated during early hours of infection and crustin-3 during late period of infection. However, ALF was found to be up-regulated early to late period of WSSV infection. The present study suggests that AMPs viz. ALF and crustin-3 play an important role in antiviral defense in shrimps. WSSV gene transcripts were detected post-challenge day 1 itself and increased considerably day 5 onwards. Evaluation of the control genes confirmed ELF as the most reliable control gene followed by 18S rRNA and β-actin for gene expression studies in shrimps. This study indicated the role of AMPs in the protection of shrimps against viral infection and their possible control through the up-regulation of AMPs

Adrenergic and muscarinic receptor subtypes functional regulation during diabetogenesis: Effect of curcumin and vitamin D3 pre-treatment

In the present study, the initial phase was directed to confirm the effects of curcumin and vitamin D3 in preventing or delaying diabetes onset by studying the blood glucose and insulin levels in the pre-treated and diabetic groups. Behavioural studies were conducted to evaluate the cognitive and motor function in experimental rats. The major focus of the study was to understand the cellular and neuronal mechanisms that ensure the prophylactic capability of curcumin and vitamin D3. To elucidate the mechanisms involved in conferring the antidiabetogenesis effect, we examined the DNA and protein profiles using radioactive incorporation studies for DNA synthesis, DNA methylation and protein synthesis. Furthermore the gene expression studies of Akt-1, Pax, Pdx-1, Neuro D1, insulin like growth factor-1 and NF-κB were done to monitor pancreatic beta cell proliferation and differentiation. The antioxidant and antiapoptotic actions of curcumin and vitamin D3 were examined by studying the expression of antioxidant enzymes - SOD and GPx, and apoptotic mediators like Bax, caspase 3, caspase 8 and TNF-α. In order to understand the signalling pathways involved in curcumin and vitamin D3 action, the second messengers, cAMP, cGMP and IP3 were studied along with the expression of vitamin D receptor in the pancreas. The neuronal regulation of pancreatic beta cell maintenance, proliferation and insulin release was studied by assessing the adrenergic and muscarinic receptor functional regulation in the pancreas, brain stem, hippocampus and hypothalamus. The receptor number and binding affinity of total muscarinic, muscarinic M1, muscarinic M3, total adrenergic, α adrenergic and β adrenergic receptor subtypes were studied in pancreas, brain stem and hippocampus of experimental rats. The mRNA expression of muscarinic and adrenergic receptor subtypes were determined using Real Time PCR. Immunohistochemistry studies using confocal microscope were carried out to confirm receptor density and gene expression results. Cell signalling alterations in the pancreas and brain regions associated with diabetogenesis and antidiabetogenesis were assessed by examining the gene expression profiles of vitamin D receptor, CREB, phospholipase C, insulin receptor and GLUT. This study will establish the anti-diabetogenesis activity of curcumin and vitamin D3 pre-treatment and will attempt to understand the cellular, molecular and neuronal control mechanism in the onset of diabetes.Administration of MLD-STZ to curcumin and vitamin D3 pre-treated rats induced only an incidental prediabetic condition. Curcumin and vitamin D3 pretreated groups injected with MLD-STZ exhibited improved circulating insulin levels and behavioural responses when compared to MLD-STZ induced diabetic group. Activation of beta cell compensatory response induces an increase in pancreatic insulin output and beta cell mass expansion in the pre-treated group. Cell signalling proteins that regulate pancreatic beta cell survival, insulin release, proliferation and differentiation showed a significant increase in curcumin and vitamin D3 pre-treated rats. Marked decline in α2 adrenergic receptor function in pancreas helps to relent sympathetic inhibition of insulin release. Neuronal stimulation of hyperglycemia induced beta cell compensatory response is mediated by escalated signalling through β adrenergic, muscarinic M1 and M3 receptors. Pre-treatment mediated functional regulation of adrenergic and cholinergic receptors, key cell signalling proteins and second messengers improves pancreatic glucose sensing, insulin gene expression, insulin secretion, cell survival and beta cell mass expansion in pancreas. Curcumin and vitamin D3 pre-treatment induced modulation of adrenergic and cholinergic signalling in brain stem, hippocampus and hypothalamus promotes insulin secretion, beta cell compensatory response, insulin sensitivity and energy balance to resist diabetogenesis. Pre-treatment improved second messenger levels and the gene expression of intracellular signalling molecules in brain stem, hippocampus and hypothalamus, to retain a functional neuronal response to hyperglycemia. Curcumin and vitamin D3 protect pancreas and brain regions from oxidative stress by their indigenous antioxidant properties and by their ability to stimulate cellular free radical defence system. The present study demonstrates the role of adrenergic and muscarinic receptor subtypes functional regulation in curcumin and vitamin D3 mediated anti-diabetogenesis. This will have immense clinical significance in developing effective strategies to delay or prevent the onset of diabetes.

A model of seed dormancy in wild oats (Avena fatua) for investigating genotype x environment interactions

Dormancy is an adaptive trait in seed populations that helps ensure that seed germination is distributed over time and occurs in environmental conditions suitable for seedling growth. Several genes.. associated with seed dormancy in various plant species, have been integrated into a hypothetical dormancy model for Avena fatua L. (wild oats). Generally, the synthesis of, and sensitivity to, abscisic acid (ABA) during imbibition determines whether genes similar to those during maturation are expressed leading to a maintenance of dormancy during extended imbibition. Alternatively, there may be a shift towards expression of genes associated with gibberellins leading to germination. Environmental factors during maturation, after-ripening and imbibition are likely to interact with the genotype to affect gene expression and hence whether or not a seed germinates. In spite of the difficulties of working on a hexaploid species, A. fatua was selected for study because of its worldwide importance as a weed. Dormant and non-dormant genotypes of this species were also available. Gene expression studies are being carried out on three A.fatua genotypes produced tinder different environmental conditions to investigate the role of specific genes in dormancy and genotype X environment interactions in relation to dormancy.

Sterol content analysis suggests altered eburicol 14 alpha-demethylase (CYP51) activity in isolates of Mycosphaerella graminicola adapted to azole fungicides

The recent decline in the effectiveness of some azole fungicides in controlling the wheat pathogen Mycosphaerella graminicola has been associated with mutations in the CYP51 gene encoding the azole target, the eburicol 14 alpha-demethylase (CYP51), an essential enzyme of the ergosterol biosynthesis pathway. In this study, analysis of the sterol content of M. graminicola isolates carrying different variants of the CYP51 gene has revealed quantitative differences in sterol intermediates, particularly the CYP51 substrate eburicol. Together with CYP51 gene expression studies, these data suggest that mutations in the CYP51 gene impact on the activity of the CYP51 protein.

Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI

Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10(-7). Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits.

Genetic variation in GABRB3 is associated with Asperger syndrome and multiple endophenotypes relevant to autism.

BACKGROUND: Autism spectrum conditions (ASC) are associated with deficits in social interaction and communication, alongside repetitive, restricted, and stereotyped behavior. ASC is highly heritable. The gamma-aminobutyric acid (GABA)-ergic system has been associated consistently with atypicalities in autism, in both genetic association and expression studies. A key component of the GABA-ergic system is encoded by the GABRB3 gene, which has been previously implicated both in ASC and in individual differences in empathy. METHODS: In this study, 45 genotyped single nucleotide polymorphisms (SNPs) within GABRB3 were tested for association with Asperger syndrome (AS), and related quantitative traits measured through the following tests: the Empathy Quotient (EQ), the Autism Spectrum Quotient (AQ), the Systemizing Quotient-Revised (SQ-R), the Embedded Figures Test (EFT), the Reading the Mind in the Eyes Test (RMET), and the Mental Rotation Test (MRT). Two-loci, three-loci, four-loci haplotype analyses, and one seven-loci haplotype analysis were also performed in the AS case--control sample. RESULTS: Three SNPs (rs7180158, rs7165604, rs12593579) were significantly associated with AS, and two SNPs (rs9806546, rs11636966) were significantly associated with EQ. Two SNP-SNP pairs, rs12438141-rs1035751 and rs12438141-rs7179514, showed significant association with variation in the EFT scores. One SNP-SNP pair, rs7174437-rs1863455, was significantly associated with variation in the MRT scores. Additionally, a few haplotypes, including a 19 kb genomic region that formed a linkage disequilibrium (LD) block in our sample and contained several nominally significant SNPs, were found to be significantly associated with AS. CONCLUSION: The current study confirms the role of GABRB3 as an important candidate gene in both ASC and normative variation in related endophenotypes.

STX1A and Asperger syndrome: a replication study

Background Autism spectrum conditions (ASC) are a group of conditions characterized by difficulties in communication and social interaction, alongside unusually narrow interests and repetitive, stereotyped behaviour. Genetic association and expression studies have suggested an important role for the GABAergic circuits in ASC. Syntaxin 1A (STX1A) encodes a protein involved in regulation of serotonergic and GABAergic systems and its expression is altered in autism. Methods In this study, the association between three single nucleotide polymorphisms (SNPs) (rs4717806, rs941298 and rs6951030) in STX1A gene and Asperger syndrome (AS) were tested in 650 controls and 479 individuals with AS, all of Caucasian ancestry. Results rs4717806 (P=0.00334) and rs941298 (P=0.01741) showed a significant association with AS, replicating previous results. Both SNPs putatively alter transcription factor binding sites both directly and through other variants in high linkage disequilibrium. Conclusions The current study confirms the role of STX1A as an important candidate gene in ASC. The exact molecular mechanisms through which STX1A contributes to the etiology remain to be elucidated.

Single nucleotide polymorphism rs6716901 in SLC25A12 gene is associated with Asperger syndrome

BACKGROUND: Autism Spectrum Conditions (ASC) are a group of developmental conditions which affect communication, social interactions and behaviour. Mitochondrial oxidative dysfunction has been suggested as a mechanism of autism based on the results of multiple genetic association and expression studies. SLC25A12 is a gene encoding a calcium-binding carrier protein that localizes to the mitochondria and is involved in the exchange of aspartate for glutamate in the inner membrane of the mitochondria regulating the cytosolic redox state. rs2056202 SNP in this gene has previously been associated with ASC. SNPs rs6716901 and rs3765166 analysed in this study have not been previously explored in association with AS. METHODS: We genotyped three SNPs (rs2056202, rs3765166, and rs6716901) in SLC25A12 in n?=?117 individuals with Asperger syndrome (AS) and n?=?426 controls, all of Caucasian ancestry. RESULTS: rs6716901 showed significant association with AS (P?=?0.008) after correcting for multiple testing. We did not replicate the previously identified association between rs2056202 and AS in our sample. Similarly, rs3765166 (P?=?0.11) showed no significant association with AS. CONCLUSION: The present study, in combination with previous studies, provides evidence for SLC25A12 as involved in the etiology of AS. Further cellular and molecular studies are required to elucidate the role of this gene in ASC.

Wheat seed embryo excision enables the creation of axenic seedlings and Koch’s postulates testing of putative bacterial endophytes

Early establishment of endophytes can play a role in pathogen suppression and improve seedling development. One route for establishment of endophytes in seedlings is transmission of bacteria from the parent plant to the seedling via the seed. In wheat seeds, it is not clear whether this transmission route exists, and the identities and location of bacteria within wheat seeds are unknown. We identified bacteria in the wheat (Triticum aestivum) cv. Hereward seed environment using embryo excision to determine the location of the bacterial load. Axenic wheat seedlings obtained with this method were subsequently used to screen a putative endophyte bacterial isolate library for endophytic competency. This absence of bacteria recovered from seeds indicated low bacterial abundance and/or the presence of inhibitors. Diversity of readily culturable bacteria in seeds was low with 8 genera identified, dominated by Erwinia and Paenibacillus. We propose that anatomical restrictions in wheat limit embryo associated vertical transmission, and that bacterial load is carried in the seed coat, crease tissue and endosperm. This finding facilitates the creation of axenic wheat plants to test competency of putative endophytes and also provides a platform for endophyte competition, plant growth, and gene expression studies without an indigenous bacterial background.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

ZmPUMP encodes a maize mitochondrial uncoupling protein that is induced by oxidative stress

A cDNA clone (designated ZmPUMP) encoding an uncoupling protein (UCP) from maize (Zea mays) was identified by searching for homologous sequences among the expressed sequence tags of the GenBank database. The ZmPUMP cDNA contains a single open reading frame of 933 nucleotides encoding 310 amino acids. Several features identified the predicted ZmPUMP protein as a member of the mitochondrial UCP subfamily of mitochondrial carriers. Expression studies demonstrated that ZmPUMP is ubiquitously expressed in maize tissues and its transcript level is not altered in early stages of embryo germination. In contrast to known UCP genes, ZmPUMP is not responsive to cold stress. Instead its expression is increased in response to H 2O 2- or menadione-induced oxidative stress. © 2003 Elsevier Science Ireland Ltd. All rights reserved.