981 resultados para chromosomal inversion polymorphisms


Relevância:

20.00% 20.00%

Publicador:

Resumo:

We aimed to study patterns of variation and factors influencing the evolutionary dynamics of a satellite DNA, pBuM, in all seven Drosophila species from the buzzatii cluster (repleta group). We analyzed 117 alpha pBuM-1 (monomer length 190 bp) and 119 composite alpha/beta (370 bp) pBuM-2 repeats and determined the chromosome location and long-range organization on DNA fibers of major sequence variants. Such combined methodologies in the study of satDNAs have been used in very few organisms. In most species, concerted evolution is linked to high copy number of pBuM repeats. Species presenting low-abundance and scattered distributed pBuM repeats did not undergo concerted evolution and maintained part of the ancestral inter-repeat variability. The alpha and alpha/beta repeats colocalized in heterochromatic regions and were distributed on multiple chromosomes, with notable differences between species. High-resolution FISH revealed array sizes of a few kilobases to over 0.7 Mb and mutual arrangements of alpha and alpha/beta repeats along the same DNA fibers, but with considerable changes in the amount of each variant across species. From sequence, chromosomal and phylogenetic data, we could infer that homogenization and amplification events involved both new and ancestral pBuM variants. Altogether, the data on the structure and organization of the pBuM satDNA give insights into genome evolution including mechanisms that contribute to concerted evolution and diversification.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ozone is a major air pollutant with adverse health effects which exhibit marked inter-individual variability. In mice, regions of genetic linkage with ozone-induced lung injury include the tumor necrosis factor-alpha (TNF), lymphotoxin-alpha (LTA), Toll-like receptor 4 (TLR4), superoxide dismutase (SOD2), and glutathione peroxidase (GPX1) genes. We genotyped polymorphisms in these genes in 51 individuals who had undergone ozone challenge. Mean change in FEV1 with ozone challenge, as a percentage of baseline, was -3% in TNF -308G/A or A/A individuals, compared with -9% in G/G individuals (p = 0.024). When considering TNF haplotypes, the smallest change in FEV1 with ozone exposure was associated with the TNF haplotype comprising LTA +252G/TNF -1031T/TNF -308A/TNF -238G. This association remained statistically significant after correction for age, sex, disease, and ozone concentration (p = 0.047). SOD2 or GPX1 genotypes were not associated with lung function, and the TLR4 polymorphism was too infrequent to analyze. The results of this study support TNF as a genetic factor for susceptibility to ozone-induced changes in lung function in humans, and has potential implications for stratifying health risks of air pollution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) and cystathionine P-synthase (CBS) genes, involved in the intracellular metabolism of homocysteine (Hcy), can result in hyperhomocysteinemia. The objective of this study was to evaluate prevalence estimates of CBS T833C, G919A and the insertion of 68-bp (844ins68) polymorphisms and their correlation with Hcy, folate and 131, in 220 children previously genotyped for MTHFR C677T, A1298C, and MTRR A66G. The prevalence of heterozygote children for 844ins68 was 19.5%. The T833C CBS mutation was identified in association with 844ins68 in all the carriers of the insertion. Genotyping for CBS G919A mutation showed that all the children presented the GG genotype. Analysis of Hcy, B(12) and folate, according to the combination of the different genotypes of the C677T and A1298C MTHFR, A66G MTRR, and 844ins68 CBS showed that the 677TT/1298AA/68WW genotype is associated with an increase in Hcy, when compared to the 677CC/1298AC/68WW (P = 0.033) and the 677CT/1298AA/68WW genotypes (P = 0.034). Since B(12) and folate were not different between these groups, a genetic interaction between diverse polymorphisms probably influences Hcy. Our results emphasize the role of genetic interactions in Hcy levels. (C) 2008 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Angiotensinogen (AGT) gene polymorphisms have been linked to increased risk of hypertension, but the data remain controversial. In this study we review the most commonly investigated polymorphisms at the AGT locus (other than M235T) and provide summary estimates regarding their association with essential hypertension, while addressing heterogeneity, as well as publication biases. Data on 26 818 subjects from 46 studies for the 4 most-studied AGT variants (T174M in exon 2 and 3 promoter variants: A-6G, A-20C, and G-217A) were meta-analyzed. Statistically significant associations with hypertension were identified for the T174M ( odds ratio [OR]: 1.19; 95% CI: 1.07 to 1.33; P = 0.002) and G-217A (OR: 1.37; 95% CI: 1.17 to 1.59; P = 0.00006) polymorphisms. A dual but consistent effect was observed for the -20C allele, which was associated with a decreased risk of hypertension in populations of mixed and European ancestries (OR: 0.64; 95% CI: 0.44 to 0.92; P = 0.02 and OR: 0.77; 95% CI: 0.65 to 0.91; P = 0.003, respectively), but with a 24% increase in the odds of hypertension in Asian subjects (OR: 1.24; 95% CI: 1.04 to 1.48; P = 0.02). No association of the A-6G variant with hypertension was detected. Current studies support the notion that single variants at the AGT might modulate the risk of hypertension but indicate caution in interpreting these results because of the putative presence of publication bias and gene-environment interactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: Association between ADAMTS13 levels and cardiovascular events has been described recently. However, no genetic study of ADAMTS13 in coronary patients has been described. Materials and Methods: Based on related populations frequencies and functional studies, we tested three ADAMTS13 polymorphisms: C1342G (Q448E), C1852G (P618A) and C2699T (A900V) in a group of 560 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. The incidence of the 5-year end-points of death and death from cardiac causes, myocardial infarction, refractory angina requiring revascularization and cerebrovascular accident was determined for each polymorphim`s allele, genotype and haplotype. Risk was assessed with the use of logistic regression and Cox proportional-hazards model and multivariable adjustment was employed for possible confounders. Results: Clinical characteristics and received treatment of each genotype group were similar at baseline. In an adjusted model for cardiovascular risk variables, we were able to observe a significant association between ADAMTS13 900V variant and an increased risk of death (OR: 1,92 CI: 1,14-3,23, p = 0,015) or death from cardiac cause (OR: 2,67, CI: 1,59-4,49, p = 0,0009). No association between events and ADAMTS13 Q448E or P618A was observed. Conclusions: This first report studying the association between ADAMTS13 genotypes and cardiovascular events provides evidence for the association between ADAMTS13 900V variant and an increased risk of death in a population with multi-vessel CAD. (C) 2009 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: Null genotypes of glutathione S-transferase (GSTs) exhibit absence of enzymatic activity and are hypothesized to modulate an increased risk of developing cardiovascular disease. The aim of this study was to identify the potential association between GSTM1 and GSTT1 deleted polymorphisms with cardiovascular risk factors and coronary atherosclerosis in two independent urban populations. Methods and results: Genotype distribution of GSTM1 and GSTT1 deleted polymorphism were examined in a sample of 1577 individuals from the general population and a replication sample of 871 individuals submitted to coronary angiography. Triglycerides, HDL-cholesterol and the triglycerides/HDL ratio were significantly associated with a double-deleted genotype in individuals from the general population. These findings were replicated in a second, independent, population of individuals submitted to coronary angiography. In addition, coronary artery disease severity was also associated with GSTs genotypes and the risk conferred from GSTs genotype was mainly due to triglycerides/HDL ratio information. Conclusions: The data suggest that the presence of a double deletion genotypes of the GSTM1 and GSTT1 genes is associated with hypertriglyceridemia and low HDL-cholesterol levels in humans. These novel findings may provide a new unexplored link between lipid metabolism and GST homeostasis. (C) 2009 Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: UV radiation is the major environmental factor related to development of cutaneous melanoma. Besides sun exposure and the influence of latitude, some host characteristics such as skin phototype and hair and eye color are also risk factors for melanoma. Polymorphisms in DNA repair genes could be good candidates for susceptibility genes, mainly in geographical regions exposed to high solar radiation. Objective: Evaluate the role of host characteristic.; and DNA repair polymorphism in melanoma risk in Brazil. Methods: We carried out a hospital-based case-control study in Brazil to evaluate the contribution of host factors and polymorphisms in DNA repair to melanoma risk. A total of 412 patients (202 with melanoma and 210 controls) were analyzed regarding host characteristics for melanoma risk as well as for 11 polymorphisms in DNA repair genes. Results: We found an association of host characteristics with melanoma development, such as eye and hair color, fair skin, history of pigmented lesions removed, sunburns in childhood and adolescence, and also European ancestry. Regarding DNA repair gene polymorphisms, we found protection for the XPG 1104 His/His genotype (OR 0.32; 95% CI 0.13-0.75), and increased risk for three polymorphisms in the XPC gene (PAT+; IV-6A and 939Gln), which represent a haplotype for XPC. Melanoma risk was higher in individuals carrying the complete XPC haplotype than each individual polymorphism (OR 3.64; 95% CI 1.77-7.48). Conclusions: Our data indicate that the host factors European ancestry and XPC polymorphisms contributed to melanoma risk in a region exposed to high sun radiation. (C) 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

XPC participates in the initial recognition of DNA damage during the DNA nucleotide excision repair process in global genomic repair. Polymorphisms in XPC gene have been analyzed in case-control studies to assess the cancer risk attributed to these variants, but results are conflicting. To clarify the impact of XPC polymorphisms in cancer risk, we performed a meta-analysis that included 33 published case-control studies. Polymorphisms analyzed were Lys939Gln and Ala499Val. The overall summary odds ratio (OR) for the associations of the 939Gln/Gln genotype with risk of cancer was 1.01 (95% confidence interval (95% CI): 0.94-1.09), but there were statistically significant associations for lung cancer, observed for the recessive genetic model (Lys/Lys + Lys/Gln vs Gln/Gln), (OR 1.30; 95% CI: 1.113-1.53), whereas for breast cancer a reduced but nonsignificant risk was observed for the same model (OR 0.87; 95% CI: 0.74-1.01). The results for Ala499Val showed a significant overall increase in cancer risk (OR 1.15; 95% CI: 1.02-1.31), and for bladder cancer in both the simple genetic model (Ala/Ala vs Val/Val) (OR 1.30; 95% CI: 1.04-1.61) and the recessive genetic model (Ala/Ala + Ala/Val vs Val/Val) (OR 1.32; 95% CI: 1.06-1.63). Our meta-analysis supports that polymorphisms in XPC may represent low-penetrance susceptibility gene variants for breast, bladder, head and neck, and lung cancer. XPC is a good candidate for large-scale epidemiological case-control studies that may lead to improvement in the management of highly prevalent cancers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polymorphisms of chemokines and chemokine-receptors genes have been shown to influence the rate of progression to AIDS; however, their influence on response to HAART remains unclear. We investigated the frequency of the SDF-1-3`A, CCR2-64I, CCR5-D32 and CCR5-Promoter-59029-A/G polymorphisms in Brazilian HIV-1-infected and uninfected individuals and their influence on CD4+ T-cell evolution HIV-1 infected individuals before and during HAART. Polymorphism detection was done in a transversal study of 200 HIV-1-infected and 82 uninfected individuals. The rate of CD4+ T cell increase or decrease was studied in a cohort of 155 HIV-1 infected individuals on pre and post-HAART. Polymorphisms were determined by PCR associated with RFLP. The rate of CD4+ T-cell decline or increase was also determined. HIV-1 infected and uninfected subjects showed, respectively, frequencies of 0.193 and 0.220 for SDF-1-3`A, of 0.140 and 0.110 for CCR2-V64I, of 0.038 and 0.055 for CCR5-D32, and of 0.442 and 0.390 for CCR5-P-59029-A/G. HIV-1-infected subjects carrying one, two or three of these four polymorphisms showed better CD4+ T-cell recovery than HIV-1-infected subjects carrying the four wild-type alleles (+2.7, +1.6, +3.5, and -0.9 lymphocytes/mu l/month, respectively). Regression logistic analysis showed that the CCR5-D32/CCR2-V64I association was predictor of positive CD4+ T cell slope after HAART. The distribution of polymorphisms did not differ between HIV-1-infected and uninfected individuals, but differed from more homogenous ethnic groups probably reflecting the miscegenation of the Brazilian population. We add further evidence of the role of these polymorphisms by showing that the CD4 gain was influenced by carriage of one or more of the polymorphisms studied here. These results highlight the possibility that these genetic traits can be useful to identify patients at risk for faster progression to AIDS or therapeutic failure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background and Aims: Although the metabolic risk factors for non-alcoholic fatty liver disease (NAFLD) progression have been recognized, the role of genetic susceptibility remains a field to be explored. The aim of this study was to examine the frequency of two polymorphisms in Brazilian patients with biopsy-proven simple steatosis or non-alcoholic steatohepatitis (NASH): -493 G/T in the MTP gene, which codes the protein responsible for transferring triglycerides to nascent apolipoprotein B, and -129 C/T in the GCLC gene, which codes the catalytic subunit of glutamate-cystein ligase in the formation of glutathione. Methods: One hundred and thirty-one biopsy-proven NAFLD patients (n = 45, simple steatosis; n = 86, NASH) and 141 unrelated healthy volunteers were evaluated. Genomic DNA was extracted from peripheral blood cells, and the -129 C/T polymorphism of the GCLC gene was determined by restriction fragment length polymorphism (RFLP). The -493 G/T polymorphism of the MTP gene was determined by direct sequencing of the polymerase chain reaction products. Results: The presence of at least one T allele in the -129 C/T polymorphism of the GCLC gene was independently associated with NASH (odds ratio 12.14, 95% confidence interval 2.01-73.35; P = 0.007), whereas, the presence of at least one G allele in the -493 G/T polymorphism of the MTP gene differed slightly between biopsy-proven NASH and simple steatosis. Conclusion: This difference clearly warrants further investigation in larger samples. These two polymorphisms could represent an additional factor for consideration in evaluating the risk of NAFLD progression. Further studies involving a larger population are necessary to confirm this notion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: Pancreas susceptibility to alcohol is variable and only 5-10% of chronic alcohol abusers develop chronic pancreatitis; the role of genetic factors in this process is unknown. The CFTR gene encodes a protein that acts on epithelial cells and plays a key role in normal exocrine pancreatic function. Methods: This study investigated the frequency of polymorphisms in intron 8 of the CFTR gene in patients with alcoholic chronic pancreatitis. Three groups of patients were studied: group A-68 adult alcoholics with a diagnosis of chronic pancreatitis; group B-68 adult alcoholics without pancreatic disease or liver cirrhosis and group C-104 healthy nonalcoholic adults. Results: T5/T7 genotype was more frequent in group A (11.8%) than in group B (2.9%) (p = 0.0481), and there was no statistical difference when groups A and C (5.8%) were compared (p = 0.1317). The haplotype combination (TG) 10-T7/(TG) 11-T7 was more frequent in groups B (23.5%) and C (20.2%) than in group A (7.3%) (p = 0.0080 and 0.0162). Conclusion: There are differences when these three groups are compared and individuals with T5/T7 genotype might have a greater risk of developing chronic pancreatitis when they become chronic alcoholics. Copyright (C) 2008 S. Karger AG, Basel and IAP

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ergosterol is an important compound responsible to maintain integrity and fluidity of Leishmania spp. membranes. Starting from an overexpression/selection method, our group has isolated and mapped nine different loci of Leishmania (L.) major related to resistance against two inhibitors of the ergosterol biosynthesis pathway, terbinafine (TBF) and itraconazole (ITZ). Individual functional analysis after overexpression induction of these loci in the presence of TBF and/or ITZ [or the ITZ analog ketoconazole (CTZ)] have shown low but significant levels of resistance after transfection into L. major wild-type parasites. In this work, we have shown the insert mapping and chromosomal identification of one of these loci (cosItz2). Functional analysis experiments associated with chromosomal localization by comparison at genomic database allowed us to identify two prospective gene-protein systems not related to the ergosterol biosynthesis and capable to confer wild-type cells resistance to ITZ-CTZ after transfection. We expected that this approach can open new insights for a better understanding of mechanisms of ITZ-CTZ action and resistance in Leishmania resulting in new strategies for the leishmaniasis treatment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aims: The incidence of head and neck cancer (HNC) in Brazil has increased substantially in recent years. This increase is likely to be strongly associated with alcohol and tobacco consumption, but genetic susceptibility also should be investigated in this population. The aim of this study was to evaluate the association of polymorphisms in genes of alcohol metabolism enzymes and the risk of HNC. Methods: A hospital-based case-control study was conducted in Sao Paulo, Brazil. We here investigated ADH1C Ile(350)Val, ADH1B Arg(48)His, ADH1B Arg(370)Cys and CYP2E1*5A PstI polymorphisms by PCR-RFLP Polymerase Chain Reaction - Restriction Fragment Length Polymorphism in 207 histopathologically confirmed HNC cases (184 males and 23 females) and 244 cancer-free controls (225 males and 19 females) admitted as in-patients in the same hospital. Results: Chronic alcohol intake increased approximately four times the risk of HNC. The mutant genotype ADH1B Arg(48)His was more frequent in controls (12.7%) than HNC patients (5.8%) conferring protection for the disease (odds ratio (OR) = 0.42; 95% confidence interval (CI ), 0.21-0.85). Similar results were observed for individuals with ADH1B*2 (OR = 0.41; 95% CI , 0.20-0.82) or ADH1B*2/ADH1C*1 (OR = 0.32; 95% CI , 0.13-0.79) mutated haplotypes. Multiple regression analyses showed that individuals with the mutant genotype ADH1B Arg(48)His who consume alcohol > 30 g/L/day have more than four times the risk for HNC (OR = 4.42; 95% CI, 1.21-16.11). Conclusions: The fast alcohol metabolizing genotypes may prevent HNC when the amount of alcohol intake is < 30.655 g/L/day.