961 resultados para Regulatory T-cell


Relevância:

40.00% 40.00%

Publicador:

Resumo:

The aim of this study was to investigate the expression of p53, caspase-3, bcl-2, MIB-1, and PCNA to validate more objective methods to differentiate squamous cell carcinoma and keratoacanthoma, as well as to understand their pathogenesis with accuracy. A total of 52 cases of histopathologically diagnosed keratoacanthoma in the proliferative stage and 56 cases of well-differentiated squamous cell carcinoma were selected in this study. The expression was evaluated by means of immunohistochemistry. Bcl-2 immunoreactivity was weak or absent in the majority of cases, either in squamous cell carcinoma or in keratoacanthoma. PCNA-positive cells did not show differences between two lesions evaluated. on the other hand, MIB-1 was statistically significant (p<0.05) between squamous cell carcinomas and keratoacanthomas. Moreover, p53 and caspase-3 were overexpressed in squamous cell carcinomas. Together, these results suggest that the biological behavior of the well-differentiated squanous cell carcinomas of the skin may be associated with cellular proliferation and/or deregulation of cell death, indicated by increased expression of the MIB-1 and apoptotic proteins p53 and caspase-3, respectively. (C) 2007 Elsevier GrnbH. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

B-cell-specific Moloney murine leukemia virus integration site 1 (Bmi-1) is a Polycomb group protein that is able to induce telomerase activity, enabling the immortalization of epithelial cells. Immortalized cells are more susceptible to double-strand breaks (DSB), which are subsequently repaired by homologous recombination (HR). BRCA1 is among the HR regulatory genes involved in the response to DNA damage associated with the RAD51 protein, which accumulates in DNA damage foci after signaling H2AX, another important marker of DNA damage. Topoisomerase III beta (topoIII beta) removes HR intermediates before chromosomal segregation, preventing damage to cellular DNA structure. In breast carcinomas positive for BMI-1 the role of proteins involved in HR remains to be investigated. The aim of this study was to evaluate the association between BMI-1 and homologous recombination proteins. Using tissue microarrays containing 239 cases of primary breast tumors, the expression of Bmi-1, BRCA-1, H2AX, Rad51, p53, Ki-67, topoIII beta, estrogen receptors (ER), progesterone receptors (PR), and HER-2 was analyzed by immunohistochemistry. We observed high Bmi-1 expression in 66 cases (27.6%). Immunohistochemical overexpression of BMI-1 was related to ER (p=0.004), PR (p<0.001), Ki-67 (p<0.001), p53 (p=0.003), BRCA1 (p=0.003), H2AX (p=0.024) and topoIII beta (p<0,001). Our results show a relationship between the expression of BMI-1 and HR regulatory genes, suggesting that Bmi-1 overexpression might be an important event in HR regulation. However, further studies are necessary to understand the mechanisms in which Bmi-1 could regulate HR pathways in invasive ductal breast carcinomas.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Foxp3(+)CD25(+)CD4(+) regulatory T cells are vital for peripheral tolerance and control of tissue inflammation. In this study, we characterized the phenotype and monitored the migration and activity of regulatory T cells present in the airways of allergic or tolerant mice after allergen challenge. To induce lung allergic inflammation, mice were sensitized twice with ovalbumin/aluminum hydroxide gel and challenged twice with intranasal ovalbumin. Tolerance was induced by oral administration of ovalbumin for 5 consecutive days prior to OVA sensitization and challenge. We detected regulatory T cells (Foxp3(+)CD25(+)CD4(+) T cells) in the airways of allergic and tolerant mice; however, the number of regulatory T cells was more than 40-fold higher in allergic mice than in tolerant mice. Lung regulatory T cells expressed an effector/memory phenotype (CCR4(high)CD62L(low)CD44(high)CD54(high)CD69(+)) that distinguished them from naive regulatory T cells (CCR4(int)CD62L(high)CD44(int)CD54(int)CD69(-)). These regulatory T cells efficiently suppressed pulmonary T-cell proliferation but not Th2 cytokine production.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Solid organ transplantation (SOT) is considered the treatment of choice for many end-stage organ diseases. Thus far, short term results are excellent, with patient survival rates greater than 90% one year post-surgery, but there are several problems with the long term acceptance and use of immunosuppressive drugs. Hematopoietic Stem Cells Transplantation (HSCT) concerns the infusion of haematopoietic stem cells to re-establish acquired and congenital disorders of the hematopoietic system. The main side effect is the Graft versus Host Disease (GvHD) where donor T cells can cause pathology involving the damage of host tissues. Patients undergoing acute or chronic GvHD receive immunosuppressive regimen that is responsible for several side effects. The use of immunosuppressive drugs in the setting of SOT and GvHD has markedly reduced the incidence of acute rejection and the tissue damage in GvHD however, the numerous adverse side effects observed boost the development of alternative strategies to improve the long-term outcome. To this effect, the use of CD4+CD25+FOXP3+ regulatory T cells (Treg) as a cellular therapy is an attractive approach for autoimmunity disease, GvHD and limiting immune responses to allograft after transplantation. Treg have a pivotal role in maintaining peripheral immunological tolerance, by preventing autoimmunity and chronic inflammation. Results of my thesis provide the characterization and cell processing of Tregs from healthy controls and patients in waiting list for liver transplantation, followed by the development of an efficient expansion-protocol and the investigation of the impact of the main immunosuppressive drugs on viability, proliferative capacity and function of expanded cells after expansion. The conclusion is that ex vivo expansion is necessary to infuse a high Treg dose and although many other factors in vivo can contribute to the success of Treg therapy, the infusion of Tregs during the administration of the highest dose of immunosuppressants should be carefully considered.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Among the many cell types that may prove useful to regenerative medicine, mounting evidence suggests that human term placenta-derived cells will join the list of significant contributors. In making new cell therapy-based strategies a clinical reality, it is fundamental that no a priori claims are made regarding which cell source is preferable for a particular therapeutic application. Rather, ongoing comparisons of the potentiality and characteristics of cells from different sources should be made to promote constant improvement in cell therapies, and such comparisons will likely show that individually tailored cells can address disease-specific clinical needs. The principle underlying such an approach is resistance to the notion that comprehensive characterization of any cell type has been achieved, neither in terms of phenotype nor risks-to-benefits ratio. Tailoring cell therapy approaches to specific conditions also requires an understanding of basic disease mechanisms and close collaboration between translational researchers and clinicians, to identify current needs and shortcomings in existing treatments. To this end, the international workshop entitled "Placenta-derived stem cells for treatment of inflammatory diseases: moving toward clinical application" was held in Brescia, Italy, in March 2009, and aimed to harness an understanding of basic inflammatory mechanisms inherent in human diseases with updated findings regarding biological and therapeutic properties of human placenta-derived cells, with particular emphasis on their potential for treating inflammatory diseases. Finally, steps required to allow their future clinical application according to regulatory aspects including good manufacturing practice (GMP) were also considered. In September 2009, the International Placenta Stem Cell Society (IPLASS) was founded to help strengthen the research network in this field.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The proinflammatory cytokine IL-6 seems to have an important role in the intestinal inflammation that characterizes inflammatory bowel diseases (IBDs) such as Crohn disease and ulcerative colitis. However, little is known about the molecular mechanisms regulating IL-6 production in IBD. Here, we assessed the role of the transcriptional regulator IFN regulatory factor-4 (IRF4) in this process. Patients with either Crohn disease or ulcerative colitis exhibited increased IRF4 expression in lamina propria CD3+ T cells as compared with control patients. Consistent with IRF4 having a regulatory function in T cells, in a mouse model of IBD whereby colitis is induced in RAG-deficient mice by transplantation with CD4+CD45RB(hi) T cells, adoptive transfer of wild-type but not IRF4-deficient T cells resulted in severe colitis. Furthermore, IRF4-deficient mice were protected from T cell-dependent chronic intestinal inflammation in trinitrobenzene sulfonic acid- and oxazolone-induced colitis. In addition, IRF4-deficient mice with induced colitis had reduced mucosal IL-6 production, and IRF4 was required for IL-6 production by mucosal CD90+ T cells, which it protected from apoptosis. Finally, the protective effect of IRF4 deficiency could be abrogated by systemic administration of either recombinant IL-6 or a combination of soluble IL-6 receptor (sIL-6R) plus IL-6 (hyper-IL-6). Taken together, our data identify IRF4 as a key regulator of mucosal IL-6 production in T cell-dependent experimental colitis and suggest that IRF4 might provide a therapeutic target for IBDs.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Previous studies have shown that Estrogen Receptor alpha (ERα) is an important indicator for diagnosis, prognosis and treatment of breast cancers. However, the question remains as to the role of ERα in the cell in the presence versus absence of 17-β estradiol In this dissertation the role of ERα in both its unliganded and liganded state, with respect to the cell cycle will be explored. The cell line models used in this project are ER-positive MCF-7 cells with and without siRNA to ERα and ER-positive MDA-MB-231 cells that have been engineered to express ERα. Cells were synchronized and the cell cycle progression was monitored by flow cytometric analysis. Using these methods, two specific questions were addressed: Does ERα modulate the cell cycle differently under liganded versus unliganded conditions? And, does the presence of ERα regulate cell cycle phase transitions? The results show for the first time that ERα is cell cycle regulated and modulates the progression of cells through S and G2/M phases of the cell cycle. Ligand bound ERα increases progression through S and G2/M phases, whereas unliganded ERα acts as an inhibitor of cell cycle progression. To further investigate the cell cycle regulated effects of liganded ERα, a luciferase assay was performed and showed that the transcription of target genes such as Progestrone Receptor (PgR) and Trefoil protein (pS2) increased duing S and G2/M phases when ERα is bound to ligand. Additionally, complex formation between cyclin B and ER α was shown by immunoprecipitation and led to the discovery that anaphase promoting complex (APC) is the E3 ligase for both cyclin B and ERα at the termination of M phase. Our findings suggest that unliganded ERα has an inhibitory effect on the progression of the cell cycle. Therefore, it is reasonable to speculate that the combination of drugs that lower estrogen level (such as aromatase inhibitors) and preserves ERα from degradation would provide better outcome for breast cancer treatment. We have shown that APC functions as the E3 ligase for ERα and thus might provide a target to design a specific inhibitor of ERα degradation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Vaccination of mice with activated autoantigen-reactive CD4+ T cells (T cell vaccination, TCV) has been shown to induce protection from the subsequent induction of a variety of experimental autoimmune diseases, including experimental allergic encephalomyelitis (EAE). Although the mechanisms involved in TCV-mediated protection are not completely known, there is some evidence that TCV induces CD8+ regulatory T cells that are specific for pathogenic CD4+ T cells. Previously, we demonstrated that, after superantigen administration in vivo, CD8+ T cells emerge that preferentially lyse and regulate activated autologous CD4+ T cells in a T cell receptor (TCR) Vβ-specific manner. This TCR Vβ-specific regulation is not observed in β2-microglobulin-deficient mice and is inhibited, in vitro, by antibody to Qa-1. We now show that similar Vβ8-specific Qa-1-restricted CD8+ T cells are also induced by TCV with activated CD4+ Vβ8+ T cells. These CD8+ T cells specifically lyse murine or human transfectants coexpressing Qa-1 and murine TCR Vβ8. Further, CD8+ T cell hybridoma clones generated from B10.PL mice vaccinated with a myelin basic protein-specific CD4+Vβ8+ T cell clone specifically recognize other CD4+ T cells and T cell tumors that express Vβ8 and the syngeneic Qa-1a but not the allogeneic Qa-1b molecule. Thus, Vβ-specific Qa-1-restricted CD8+ T cells are induced by activated CD4+ T cells. We suggest that these CD8+ T cells may function to specifically regulate activated CD4+ T cells during immune responses.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Iron regulatory proteins (IRPs) are cytoplasmic RNA binding proteins that are central components of a sensory and regulatory network that modulates vertebrate iron homeostasis. IRPs regulate iron metabolism by binding to iron responsive element(s) (IREs) in the 5′ or 3′ untranslated region of ferritin or transferrin receptor (TfR) mRNAs. Two IRPs, IRP1 and IRP2, have been identified previously. IRP1 exhibits two mutually exclusive functions as an RNA binding protein or as the cytosolic isoform of aconitase. We demonstrate that the Ba/F3 family of murine pro-B lymphocytes represents the first example of a mammalian cell line that fails to express IRP1 protein or mRNA. First, all of the IRE binding activity in Ba/F3-gp55 cells is attributable to IRP2. Second, synthesis of IRP2, but not of IRP1, is detectable in Ba/F3-gp55 cells. Third, the Ba/F3 family of cells express IRP2 mRNA at a level similar to other murine cell lines, but IRP1 mRNA is not detectable. In the Ba/F3 family of cells, alterations in iron status modulated ferritin biosynthesis and TfR mRNA level over as much as a 20- and 14-fold range, respectively. We conclude that IRP1 is not essential for regulation of ferritin or TfR expression by iron and that IRP2 can act as the sole IRE-dependent mediator of cellular iron homeostasis.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The protein known as macrophage migration inhibitory factor (MIF) was one of the first cytokines to be discovered and was described 30 years ago to be a T-cell-derived factor that inhibited the random migration of macrophages in vitro. A much broader role for MIF has emerged recently as a result of studies that have demonstrated it to be released from the anterior pituitary gland in vivo. MIF also is the first protein that has been identified to be secreted from monocytes/macrophages upon glucocorticoid stimulation. Once released, MIF acts to "override" or counter-regulate the suppressive effects of glucocorticoids on macrophage cytokine production. We report herein that MIF plays an important regulatory role in the activation of T cells induced by mitogenic or antigenic stimuli. Activated T cells produce MIF and neutralizing anti-MIF antibodies inhibit T-cell proliferation and interleukin 2 production in vitro, and suppress antigen-driven T-cell activation and antibody production in vivo. T cells also release MIF in response to glucocorticoid stimulation and MIF acts to override glucocorticoid inhibition of T-cell proliferation and interleukin 2 and interferon gamma production. These studies indicate that MIF acts in concert with glucocorticoids to control T-cell activation and assign a previously unsuspected but critical role for MIF in antigen-specific immune responses.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The Schizosaccharomyces pombe cell cycle-regulatory protein suc1, named as the suppressor of cdc2 temperature-sensitive mutations, is essential for cell cycle progression. To understand suc1 structure-function relationships and to help resolve conflicting interpretations of suc1 function based on genetic studies of suc1 and its functional homologs in both lower and higher eukaryotes, we have determined the crystal structure of the beta-interchanged suc1 dimer. Each domain consists of three alpha-helices and a four-stranded beta-sheet, completed by the interchange of terminal beta-strands between the two subunits. This beta-interchanged suc1 dimer, when compared with the beta-hairpin single-domain folds of suc1, reveals a beta-hinge motif formed by the conserved amino acid sequence HVPEPH. This beta-hinge mediates the subunit conformation and assembly of suc1: closing produces the intrasubunit beta-hairpin and single-domain fold, whereas opening leads to the intersubunit beta-strand interchange and interlocked dimer assembly reported here. This conformational switch markedly changes the surface accessibility of sequence-conserved residues available for recognition of cyclin-dependent kinase, suggesting a structural mechanism for beta-hinge-mediated regulation of suc1 biological function. Thus, suc1 belongs to the family of domain-swapping proteins, consisting of intertwined and dimeric protein structures in which the dual assembly modes regulate their function.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The mechanisms by which insulin-like growth factors (IGFs) can be both mitogenic and differentiation-promoting in skeletal myoblasts are unclear because these two processes are believed to be mutually exclusive in this tissue. The phosphorylation state of the ubiquitous nuclear retinoblastoma protein (Rb) plays an important role in determining whether myoblasts proliferate or differentiate: Phosphorylated Rb promotes mitogenesis, whereas un- (or hypo-) phosphorylated Rb promotes cell cycle exit and differentiation. We hypothesized that IGFs might affect the fate of myoblasts by regulating the phosphorylation of Rb. Although long-term IGF treatment is known to stimulate differentiation, we find that IGFs act initially to inhibit differentiation and are exclusively mitogenic. These early effects of IGFs are associated with maintenance of Rb phosphorylation typical of proliferating cells; upregulation of the gene expression of cyclin-dependent kinase 4 and cyclin D1, components of a holoenzyme that plays a principal role in mediating Rb phosphorylation; and marked inhibition of the gene expression of myogenin, a member of the MyoD family of skeletal muscle-specific transcription factors that is essential in muscle differentiation. We also find that IGF-induced inhibition of differentiation occurs through a process that is independent of its mitogenic effects. We demonstrate, thus, that IGFs regulate Rb phosphorylation and cyclin D1 and cyclin-dependent kinase 4 gene expression; together with their biphasic effects on myogenin expression, these results suggest a mechanism by which IGFs are initially mitogenic and subsequently differentiation-promoting in skeletal muscle.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.