A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Regulatory T Cells Accumulate in the Lung Allergic Inflammation and Efficiently Suppress T-Cell Proliferation but Not Th2 Cytokine Production

Foxp3(+)CD25(+)CD4(+) regulatory T cells are vital for peripheral tolerance and control of tissue inflammation. In this study, we characterized the phenotype and monitored the migration and activity of regulatory T cells present in the airways of allergic or tolerant mice after allergen challenge. To induce lung allergic inflammation, mice were sensitized twice with ovalbumin/aluminum hydroxide gel and challenged twice with intranasal ovalbumin. Tolerance was induced by oral administration of ovalbumin for 5 consecutive days prior to OVA sensitization and challenge. We detected regulatory T cells (Foxp3(+)CD25(+)CD4(+) T cells) in the airways of allergic and tolerant mice; however, the number of regulatory T cells was more than 40-fold higher in allergic mice than in tolerant mice. Lung regulatory T cells expressed an effector/memory phenotype (CCR4(high)CD62L(low)CD44(high)CD54(high)CD69(+)) that distinguished them from naive regulatory T cells (CCR4(int)CD62L(high)CD44(int)CD54(int)CD69(-)). These regulatory T cells efficiently suppressed pulmonary T-cell proliferation but not Th2 cytokine production.

Active regulatory T-cells contribute to broadened T-cell repertoire diversity in ivIg-treated SLE patients

Octapharma.

Broadened T-cell Repertoire Diversity in ivIg-treated SLE Patients is Also Related to the Individual Status of Regulatory T-cells

Intravenous IgG (ivIg) is a therapeutic alternative for lupus erythematosus, the mechanism of which remains to be fully understood. Here we investigated whether ivIg affects two established sub-phenotypes of SLE, namely relative oligoclonality of circulating T-cells and reduced activity of CD4 + Foxp3+ regulatory T-cells (Tregs) reflected by lower CD25 surface density.

Multiple regulatory variants located in cell type-specific enhancers within the PKP2 locus form major risk and protective haplotypes for canine atopic dermatitis in German shepherd dogs.

BACKGROUND Canine atopic dermatitis (CAD) is a chronic inflammatory skin disease triggered by allergic reactions involving IgE antibodies directed towards environmental allergens. We previously identified a ~1.5 Mb locus on canine chromosome 27 associated with CAD in German shepherd dogs (GSDs). Fine-mapping indicated association closest to the PKP2 gene encoding plakophilin 2. RESULTS Additional genotyping and association analyses in GSDs combined with control dogs from five breeds with low-risk for CAD revealed the top SNP 27:19,086,778 (p = 1.4 × 10(-7)) and a rare ~48 kb risk haplotype overlapping the PKP2 gene and shared only with other high-risk CAD breeds. We selected altogether nine SNPs (four top-associated in GSDs and five within the ~48 kb risk haplotype) that spanned ~280 kb forming one risk haplotype carried by 35 % of the GSD cases and 10 % of the GSD controls (OR = 5.1, p = 5.9 × 10(-5)), and another haplotype present in 85 % of the GSD cases and 98 % of the GSD controls and conferring a protective effect against CAD in GSDs (OR = 0.14, p = 0.0032). Eight of these SNPs were analyzed for transcriptional regulation using reporter assays where all tested regions exerted regulatory effects on transcription in epithelial and/or immune cell lines, and seven SNPs showed allelic differences. The DNA fragment with the top-associated SNP 27:19,086,778 displayed the highest activity in keratinocytes with 11-fold induction of transcription by the risk allele versus 8-fold by the control allele (pdifference = 0.003), and also mapped close (~3 kb) to an ENCODE skin-specific enhancer region. CONCLUSIONS Our experiments indicate that multiple CAD-associated genetic variants located in cell type-specific enhancers are involved in gene regulation in different cells and tissues. No single causative variant alone, but rather multiple variants combined in a risk haplotype likely contribute to an altered expression of the PKP2 gene, and possibly nearby genes, in immune and epithelial cells, and predispose GSDs to CAD.

Expression of apoptotic regulatory molecules in renal cell carcinoma: Elevated expression of Fas ligand

Renal cell carcinoma (RCC) is the most common renal neoplasm. Despite being infiltrated by tumour infiltrating lymphocytes (TIL), these TIL are unable to control tumour growth in vivo, suggesting that the cytotoxic capacity of TIL against RCC is impaired, or that the tumour cells are resistant to killing and therefore escape detection by the immune system. It is postulated that the expression of apoptotic regulatory molecules in RCC favours tumour cell survival. The present study has therefore determined the expression of Fas (APO- 1/CD95), Fas ligand (Fas L) and bcl-2 in these tumours. The expression of Fas, Fas L and bcl-2 mRNA transcripts was determined in RCC, normal kidney and peripheral blood by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR), following RNA extraction and cDNA synthesis from tissues and cell samples. Transcript levels were measured by densitometry after Southern blot hybridization of PCR products with internal radio-labelled oligonucleotide probes; a densitometry score was assigned to each hybridizing DNA band and expressed as a ratio of the glyceraldehyde-3-phosphate dehydrogenase content. In peripheral blood, the expression of Fas L and bcl-2 transcripts was similar between patients and normal healthy individuals; however, Fas transcript expression was significantly down-regulated in the patients' versus normal peripheral blood (P = 0.026). Most interestingly, significantly up-regulated Fas L expression was observed in RCC compared to normal kidney (P = 0.041). In contrast, bcl-2 transcripts were well represented in normal kidney but markedly decreased in RCC (P = 0.021). The expression of Fas transcripts in normal kidney and RCC was variable. These data demonstrate elevated expression of Fas L transcripts in RCC, but the functional relevance of this remains to be investigated.

Regulation of human stem cell research in Australia

Australia is currently well placed to contribute to the global growth of human stem cell research. However, as the science has progressed, authorities have had to deal with the ongoing challenges of regulating such a fast moving field of scientific endeavour. Australia’s past and current approach to regulating the use of embryos in human embryonic stem cell research provides an insight into how Australia may continue to adapt to future regulatory challenges presented by human stem cell research. In the broader context, a number of issues have been identified that may impact upon the success of future human stem cell research in Australia.

In vitro and in vivo examination of the cell surface glycoprotein CDCP1

A number of reports have demonstrated the importance of the CUB domaincontaining protein 1 (CDCP1) in facilitating cancer progression in animal models and the potential of this protein as a prognostic marker in several malignancies. CDCP1 facilitates metastasis formation in animal models by negatively regulating anoikis, a type of apoptosis triggered by the loss of attachment signalling from cell-cell contacts or cell-extra cellular matrix (ECM) contacts. Due to the important role CDCP1 plays in cancer progression in model systems, it is considered a potential drug target to prevent the metastatic spread of cancers. CDCP1 is a highly glycosylated 836 amino acid cell surface protein. It has structural features potentially facilitating protein-protein interactions including 14 N-glycosylation sites, three CUB-like domains, 20 cysteine residues likely to be involved in disulfide bond formation and five intracellular tyrosine residues. CDCP1 interacts with a variety of proteins including Src family kinases (SFKs) and protein kinase C ä (PKCä). Efforts to understand the mechanisms regulating these interactions have largely focussed on three CDCP1 tyrosine residues Y734, Y743 and Y762. CDCP1-Y734 is the site where SFKs phosphorylate and bind to CDCP1 and mediate subsequent phosphorylation of CDCP1-Y743 and -Y762 which leads to binding of PKCä at CDCP1-Y762. The resulting trimeric protein complex of SFK•CDCP1•PKCä has been proposed to mediate an anti-apoptotic cell phenotype in vitro, and to promote metastasis in vivo. The effect of mutation of the three tyrosines on interactions of CDCP1 with SFKs and PKCä and the consequences on cell phenotype in vitro and in vivo have not been examined. CDCP1 has a predicted molecular weight of ~90 kDa but is usually detected as a protein which migrates at ~135 kDa by Western blot analysis due to its high degree of glycosylation. A low molecular weight form of CDCP1 (LMWCDCP1) of ~70 kDa has been found in a variety of cancer cell lines. The mechanisms leading to the generation of LMW-CDCP1 in vivo are not well understood but an involvement of proteases in this process has been proposed. Serine proteases including plasmin and trypsin are able to proteolytically process CDCP1. In addition, the recombinant protease domain of the serine protease matriptase is also able to cleave the recombinant extracellular portion of CDCP1. Whether matriptase is able to proteolytically process CDCP1 on the cell surface has not been examined. Importantly, proteolytic processing of CDCP1 by trypsin leads to phosphorylation of its cell surface-retained portion which suggests that this event leads to initiation of an intracellular signalling cascade. This project aimed to further examine the biology of CDCP1 with a main of focus on exploring the roles played by CDCP1 tyrosine residues. To achieve this HeLa cells stably expressing CDCP1 or the CDCP1 tyrosine mutants Y734F, Y743F and Y762F were generated. These cell lines were used to examine: • The roles of the tyrosine residues Y734, Y743 and Y762 in mediating interactions of CDCP1 with binding proteins and to examine the effect of the stable expression on HeLa cell morphology. • The ability of the serine protease matriptase to proteolytically process cell surface CDCP1 and to examine the consequences of this event on HeLa cell phenotype and cell signalling in vitro. • The importance of these residues in processes associated with cancer progression in vitro including adhesion, proliferation and migration. • The role of these residues on metastatic phenotype in vivo and the ability of a function-blocking anti-CDCP1 antibody to inhibit metastasis in the chicken embryo chorioallantoic membrane (CAM) assay. Interestingly, biochemical experiments carried out in this study revealed that mutation of certain CDCP1 tyrosine residues impacts on interactions of this protein with binding proteins. For example, binding of SFKs as well as PKCä to CDCP1 was markedly decreased in HeLa-CDCP1-Y734F cells, and binding of PKCä was also reduced in HeLa-CDCP1-Y762F cells. In contrast, HeLa-CDCP1-Y743F cells did not display altered interactions with CDCP1 binding proteins. Importantly, observed differences in interactions of CDCP1 with binding partners impacted on basal phosphorylation of CDCP1. It was found that HeLa-CDCP1, HeLa-CDCP1-Y743F and -Y762F displayed strong basal levels of CDCP1 phosphorylation. In contrast, HeLa-CDCP1-Y734F cells did not display CDCP1 phosphorylation but exhibited constitutive phosphorylation of focal adhesion kinase (FAK) at tyrosine 861. Significantly, subsequent investigations to examine this observation suggested that CDCP1-Y734 and FAK-Y861 are competitive substrates for SFK-mediated phosphorylation. It appeared that SFK-mediated phosphorylation of CDCP1- Y734 and FAK-Y861 is an equilibrium which shifts depending on the level of CDCP1 expression in HeLa cells. This suggests that the level of CDCP1 expression may act as a regulatory mechanism allowing cells to switch from a FAK-Y861 mediated pathway to a CDCP1-Y734 mediated pathway. This is the first time that a link between SFKs, CDCP1 and FAK has been demonstrated. One of the most interesting observations from this work was that CDCP1 altered HeLa cell morphology causing an elongated and fibroblastic-like appearance. Importantly, this morphological change depended on CDCP1- Y734. In addition, it was observed that this change in cell morphology was accompanied by increased phosphorylation of SFK-Y416. This suggests that interactions of SFKs with CDCP1-Y734 increases SFK activity since SFKY416 is critical in regulating kinase activity of these proteins. The essential role of SFKs in mediating CDCP1-induced HeLa cell morphological changes was demonstrated using the SFK-selective inhibitor SU6656. This inhibitor caused reversion of HeLa-CDCP1 cell morphology to an epithelial appearance characteristic of HeLa-vector cells. Significantly, in vitro studies revealed that certain CDCP1-mediated cell phenotypes are mediated by cellular pathways dependent on CDCP1 tyrosine residues whereas others are independent of these sites. For example, CDCP1 expression caused a marked increase in HeLa cell motility that was independent of CDCP1 tyrosine residues. In contrast, CDCP1- induced decrease in HeLa cell proliferation was most prominent in HeLa- CDCP1-Y762F cells, potentially indicating a role for this site in regulating proliferation in HeLa cells. Another cellular event which was identified to require phosphorylation of a particular CDCP1 tyrosine residue is adhesion to fibronectin. It was observed that the CDCP1-mediated strong decrease in adhesion to fibronectin is mostly restored in HeLa-CDCP1-Y743F cells. This suggests a possible role for CDCP1-Y743 in causing a CDCP1-mediated decrease in adhesion. Data from in vivo experiments indicated that HeLa-CDCP1-Y734F cells are more metastic than HeLa-CDCP1 cells in vivo. This indicates that interaction of CDCP1 with SFKs and PKCä may not be required for CDCP1-mediated metastasis formation of HeLa cells in vivo. The metastatic phenotype of these cells may be caused by signalling involving FAK since HeLa-CDCP1- Y734F cells are the only CDCP1 expressing cells displaying constitutive phosphorylation of FAK-Y861. HeLa-CDCP1-Y762F cells displayed a very low metastatic ability which suggests that this CDCP1 tyrosine residue is important in mediating a pro-metastatic phenotype in HeLa cells. More detailed exploration of cellular events occurring downstream of CDCP1-Y734 and -Y762 may provide important insights into the mechanisms altering the metastatic ability of CDCP1 expressing HeLa cells. Complementing the in vivo studies, anti-CDCP1 antibodies were employed to assess whether these antibodies are able to inhibit metastasis of CDCP1 and CDCP1 tyrosine mutants expressing HeLa cells. It was found that HeLa- CDCP1-Y734F cells were the only cell line which was markedly reduced in the ability to metastasise. In contrast, the ability of HeLa-CDCP1, HeLa- CDCP1-Y743F and -Y762F cells to metastasise in vivo was not inhibited. These data suggest a possible role of interactions of CDCP1 with SFKs, occurring at CDCP1-Y734, in preventing an anti-metastatic effect of anti- CDCP1 antibodies in vivo. The proposal that SFKs may play a role in regulating anti-metastatic effects of anti-CDCP1 antibodies was supported by another experiment where differences between HeLa-CDCP1 cells and CDCP1 expressing HeLa cells (HeLa-CDCP1-S) from collaborators at the Scripps Research Institute were examined. It was found that HeLa-CDCP1-S cells express different SFKs than CDCP1 expressing HeLa cells generated for this study. This is important since HeLa-CDCP1-S cells can be inhibited in their metastatic ability using anti-CDCP1 antibodies in vivo. Importantly, these data suggest that further examinations of the roles of SFKs in facilitating anti-metastatic effects of anti-CDCP1 antibodies may give insights into how CDCP1 can be blocked to prevent metastasis in vivo. This project also explored the ability of the serine protease matriptase to proteolytically process cell surface localised CDCP1 because it is unknown whether matriptase can cleave cell surface CDCP1 as it has been reported for other proteases such as trypsin and plasmin. Furthermore, the consequences of matriptase-mediated proteolysis on cell phenotype in vitro and cell signalling were examined since recent reports suggested that proteolysis of CDCP1 leads to its phosphorylation and may initiate cell signalling and consequently alter cell phenotype. It was found that matriptase is able to proteolytically process cell surface CDCP1 at low nanomolar concentrations which suggests that cleavage of CDCP1 by matriptase may facilitate the generation of LWM-CDCP1 in vivo. To examine whether matriptase-mediated proteolysis induced cell signalling anti-phospho Erk 1/2 Western blot analysis was performed as this pathway has previously been examined to study signalling in response to proteolytic processing of cell surface proteins. It was found that matriptase-mediated proteolysis in CDCP1 expressing HeLa cells initiated intracellular signalling via Erk 1/2. Interestingly, this increase in phosphorylation of Erk 1/2 was also observed in HeLa-vector cells. This suggested that initiation of cell signalling via Erk 1/2 phosphorylation as a result of matriptase-mediated proteolysis occurs by pathways independent of CDCP1. Subsequent investigations measuring the flux of free calcium ions and by using a protease-activated receptor 2 (PAR2) agonist peptide confirmed this hypothesis. These data suggested that matriptase-mediated proteolysis results in cell signalling via a pathway induced by the activation of PAR2 rather than by CDCP1. This indicates that induction of cell signalling in HeLa cells as a consequence of matriptase-mediated proteolysis occurs via signalling pathways which do not involve phosphorylation of Erk 1/2. Consequently, it appears that future attempts should focus on the examination of cellular pathways other than Erk 1/2 to elucidate cell signalling initiated by matriptase-mediated proteolytic processing of CDCP1. The data presented in this thesis has explored in vitro and in vivo aspects of the biology of CDCP1. The observations summarised above will permit the design of future studies to more precisely determine the role of CDCP1 and its binding partners in processes relevant to cancer progression. This may contribute to further defining CDCP1 as a target for cancer treatment.

Multiscale analysis of protein functions and stochastic modelling of gene transcriptional regulatory networks

Genomic and proteomic analyses have attracted a great deal of interests in biological research in recent years. Many methods have been applied to discover useful information contained in the enormous databases of genomic sequences and amino acid sequences. The results of these investigations inspire further research in biological fields in return. These biological sequences, which may be considered as multiscale sequences, have some specific features which need further efforts to characterise using more refined methods. This project aims to study some of these biological challenges with multiscale analysis methods and stochastic modelling approach. The first part of the thesis aims to cluster some unknown proteins, and classify their families as well as their structural classes. A development in proteomic analysis is concerned with the determination of protein functions. The first step in this development is to classify proteins and predict their families. This motives us to study some unknown proteins from specific families, and to cluster them into families and structural classes. We select a large number of proteins from the same families or superfamilies, and link them to simulate some unknown large proteins from these families. We use multifractal analysis and the wavelet method to capture the characteristics of these linked proteins. The simulation results show that the method is valid for the classification of large proteins. The second part of the thesis aims to explore the relationship of proteins based on a layered comparison with their components. Many methods are based on homology of proteins because the resemblance at the protein sequence level normally indicates the similarity of functions and structures. However, some proteins may have similar functions with low sequential identity. We consider protein sequences at detail level to investigate the problem of comparison of proteins. The comparison is based on the empirical mode decomposition (EMD), and protein sequences are detected with the intrinsic mode functions. A measure of similarity is introduced with a new cross-correlation formula. The similarity results show that the EMD is useful for detection of functional relationships of proteins. The third part of the thesis aims to investigate the transcriptional regulatory network of yeast cell cycle via stochastic differential equations. As the investigation of genome-wide gene expressions has become a focus in genomic analysis, researchers have tried to understand the mechanisms of the yeast genome for many years. How cells control gene expressions still needs further investigation. We use a stochastic differential equation to model the expression profile of a target gene. We modify the model with a Gaussian membership function. For each target gene, a transcriptional rate is obtained, and the estimated transcriptional rate is also calculated with the information from five possible transcriptional regulators. Some regulators of these target genes are verified with the related references. With these results, we construct a transcriptional regulatory network for the genes from the yeast Saccharomyces cerevisiae. The construction of transcriptional regulatory network is useful for detecting more mechanisms of the yeast cell cycle.

Stochastic models for regulatory networks of the genetic toggle switch

Bistability arises within a wide range of biological systems from the λ phage switch in bacteria to cellular signal transduction pathways in mammalian cells. Changes in regulatory mechanisms may result in genetic switching in a bistable system. Recently, more and more experimental evidence in the form of bimodal population distributions indicates that noise plays a very important role in the switching of bistable systems. Although deterministic models have been used for studying the existence of bistability properties under various system conditions, these models cannot realize cell-to-cell fluctuations in genetic switching. However, there is a lag in the development of stochastic models for studying the impact of noise in bistable systems because of the lack of detailed knowledge of biochemical reactions, kinetic rates, and molecular numbers. In this work, we develop a previously undescribed general technique for developing quantitative stochastic models for large-scale genetic regulatory networks by introducing Poisson random variables into deterministic models described by ordinary differential equations. Two stochastic models have been proposed for the genetic toggle switch interfaced with either the SOS signaling pathway or a quorum-sensing signaling pathway, and we have successfully realized experimental results showing bimodal population distributions. Because the introduced stochastic models are based on widely used ordinary differential equation models, the success of this work suggests that this approach is a very promising one for studying noise in large-scale genetic regulatory networks.

Plant programmed cell death : Can't live with it; Can't live without it

The decision of whether a cell should live or die is fundamental for the wellbeing of all organisms. Despite intense investigation into cell growth and proliferation, only recently has the essential and equally important idea that cells control/programme their own demise for proper maintenance of cellular homeostasis gained recognition. Furthermore, even though research into programmed cell death (PCD) has been an extremely active area of research there are significant gaps in our understanding of the process in plants. In this review, we discuss PCD during plant development and pathogenesis, and compare/contrast this with mammalian apoptosis. © 2008 Blackwell Publishing Ltd.

Subcellular localization of proteasomes and their regulatory complexes in mammalian cells

Proteasomes can exist in several different molecular forms in mammalian cells. The core 20S proteasome, containing the proteolytic sites, binds regulatory complexes at the ends of its cylindrical structure. Together with two 19S ATPase regulatory complexes it forms the 26S proteasome, which is involved in ubiquitin-dependent proteolysis. The 20S proteasome can also bind 11S regulatory complexes (REG, PA28) which play a role in antigen processing, as do the three variable c-interferoninducible catalytic b-subunits (e.g. LMP7). In the present study, we have investigated the subcellular distribution of the different forms of proteasomes using subunit speci®c antibodies. Both 20S proteasomes and their 19S regulatory complexes are found in nuclear, cytosolic and microsomal preparations isolated from rat liver. LMP7 was enriched approximately two-fold compared with core a-type proteasome subunits in the microsomal preparations. 20S proteasomes were more abundant than 26S proteasomes, both in liver and cultured cell lines. Interestingly, some signi®cant differences were observed in the distribution of different subunits of the 19S regulatory complexes. S12, and to a lesser extent p45, were found to be relatively enriched in nuclear fractions from rat liver, and immuno¯uorescent labelling of cultured cells with anti-p45 antibodies showed stronger labelling in the nucleus than in the cytoplasm. The REG was found to be localized predominantly in the cytoplasm. Three- to six-fold increases in the level of REG were observed following cinterferon treatment of cultured cells but c-interferon had no obvious effect on its subcellular distribution. These results demonstrate that different regulatory complexes and subpopulations of proteasomes have different distributions within mammalian cells and, therefore, that the distribution is more complex than has been reported for yeast proteasomes.

In vitro primary cell culture as a physiologically relevant method for preclinical testing of human oncolytic adenovirus

Ad[I/PPT-E1A] is an oncolytic adenovirus that specifically kills prostate cells via restricted replication by a prostate-specific regulatory element. Off-target replication of oncolytic adenoviruses would have serious clinical consequences. As a proposed ex vivo test, we describe the assessment of the specificity of Ad[I/PPT-E1A] viral cytotoxicity and replication in human nonprostate primary cells. Four primary nonprostate cell types were selected to mimic the effects of potential in vivo exposure to Ad[I/PPT-E1A] virus: bronchial epithelial cells, urothelial cells, vascular endothelial cells, and hepatocytes. Primary cells were analyzed for Ad[I/PPT-E1A] viral cytotoxicity in MTS assays, and viral replication was determined by hexon titer immunostaining assays to quantify viral hexon protein. The results revealed that at an extreme multiplicity of infection of 500, unlikely to be achieved in vivo, Ad[I/PPT-E1A] virus showed no significant cytotoxic effects in the nonprostate primary cell types apart from the hepatocytes. Transmission electron microscopy studies revealed high levels of Ad[I/PPT-E1A] sequestered in the cytoplasm of these cells. Adenoviral green fluorescent protein reporter studies showed no evidence for nuclear localization, suggesting that the cytotoxic effects of Ad[I/PPT-E1A] in human primary hepatocytes are related to viral sequestration. Also, hepatocytes had increased amounts of coxsackie adenovirus receptor surface protein. Active viral replication was only observed in the permissive primary prostate cells and LNCaP prostate cell line, and was not evident in any of the other nonprostate cells types tested, confirming the specificity of Ad[I/PPT-E1A]. Thus, using a relevant panel of primary human cells provides a convenient and alternative preclinical assay for examining the specificity of conditionally replicating oncolytic adenoviruses in vivo.