965 resultados para Positional asphyxia


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The asymmetric unit of the title compound, Na(+)center dot C(6)H(10)NS(2) center dot 2H(2)O, is composed of a sodium cation, a piperidinedithiocarbamate anion which exhibits positional disorder, and two lattice water molecules. The atoms of the piperidine ring are divided over two sites with occupancy factors of 0.554 (6) and 0.446 (6). In the crystal, the sodium cation (coordination number of 6) and the piperidinedithiocarbamate anion are linked, forming an infinite two-dimensional network extending parallel to (001). O-H center dot center dot center dot S hydrogen bonds, involving the lattice water molecules, also aid in stabilizing the crystal sructure.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The title compound, NH(4) +center dot C(6)H(10)NS(2) -, is composed of an ammonium cation and a piperidine-1-carbodithioate anion which exhibits positional disorder. The atoms of the ring have a structural disorder and they are divided into two sites, with occupancy factors of 0.584 and 0.426.. In the crystal, the cation and anion are linked by N-H...S hydrogen bonds to form an infinite two-dimensional network.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Drosophila pair-rule genes are expressed in striped patterns with a precise order of overlap between stripes of different genes. We investigated the role of Giant (Gt) in the regulation of even-skipped, hairy, runt, and fushi tarazu stripes formed in the vicinity of Gt expression domains. In gt null embryos, specific stripes of eve, h, run, and ftz are disrupted. With an ectopic expression system, we verified that stripes affected in the mutant are also repressed. Simultaneously hybridizing gt misxpressing embryos with two pair-rule gene probes, we were able to distinguish differences in the repression of pairs of stripes that overlap extensively. Together, our results showed Gt repression roles in the regulation of two groups of partially overlapping stripes and that Gt morphogen activity is part of the mechanism responsible for the differential positioning of these stripes borders. We discuss the possibility that other factors regulate Gt stripe targets as well. Developmental Dynamics 239:2989-2999, 2010. (C) 2010 Wiley-Liss, Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The most ordinary finite element formulations for 3D frame analysis do not consider the warping of cross-sections as part of their kinematics. So the stiffness, regarding torsion, should be directly introduced by the user into the computational software and the bar is treated as it is working under no warping hypothesis. This approach does not give good results for general structural elements applied in engineering. Both displacement and stress calculation reveal sensible deficiencies for both linear and non-linear applications. For linear analysis, displacements can be corrected by assuming a stiffness that results in acceptable global displacements of the analyzed structure. However, the stress calculation will be far from reality. For nonlinear analysis the deficiencies are even worse. In the past forty years, some special structural matrix analysis and finite element formulations have been proposed in literature to include warping and the bending-torsion effects for 3D general frame analysis considering both linear and non-linear situations. In this work, using a kinematics improvement technique, the degree of freedom ""warping intensity"" is introduced following a new approach for 3D frame elements. This degree of freedom is associated with the warping basic mode, a geometric characteristic of the cross-section, It does not have a direct relation with the rate of twist rotation along the longitudinal axis, as in existent formulations. Moreover, a linear strain variation mode is provided for the geometric non-linear approach, for which complete 3D constitutive relation (Saint-Venant Kirchhoff) is adopted. The proposed technique allows the consideration of inhomogeneous cross-sections with any geometry. Various examples are shown to demonstrate the accuracy and applicability of the proposed formulation. (C) 2009 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Lychnophora ericoides Mart. (Asteraceae, Vernonieae) is a plant, endemic to Brazil, with occurrence restricted to the ""cerrado"" biome. Traditional medicine employs alcoholic and aqueous-alcoholic preparations of leaves from this species for the treatment of wounds, inflammation, and pain. Furthermore, leaves of L. ericoides are also widely used as flavorings for the Brazilian traditional spirit ""cachaca"". A method has been developed for the extraction and HPLC-DAD analysis of the secondary metabolites of L. ericoides leaves. This analytical method was validated with 11 secondary metabolites chosen to represent the different classes and polarities of secondary metabolites occurring in L. ericoides leaves, and good responses were obtained for each validation parameter analyzed. The same HPLC analytical method was also employed for online secondary metabolite identification by HPLC-DAD-MS and HPLC-DAD-MS/MS, leading to the identification of di-C-glucosylflavones, coumaroylglucosylflavonols, flavone, flavanones, flavonols, chalcones, goyazensolide, and eremantholide-type sesquiterpene lactones and positional isomeric series of chlorogenic acids possessing caffeic and/or ferulic moieties. Among the 52 chromatographic peaks observed, 36 were fully identified and 8 were attributed to compounds belonging to series of caffeoylferuloylquinic and diferuloylquinic acids that could not be individualized from each other.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new and promising nitrosyl ruthenium complex, [Ru(NO)(bdqi-COOH)(terpy)](PF(6))(3), bdqi-COOH is 3,4-diiminebenzoic acid and terpy is 2,2`-terpyridine, has been synthesized as a NO donor agent. The procedure used for [Ru(NO)(bdqi-COOH)(terpy)](PF(6))(3) synthesis has, apparently, yielded the formation of two isomers in which the ligand bdqi-COOH appears to be coordinated in its reduced form (bdcat-COOH), which could have differences in their pharmacological properties. Therefore, it was intended to separate the two possible isomers by high-performance liquid chromatography (HPLC) and to characterize them by high resolution mass spectrometry (QTOF MS) and by magnetic nuclear resonance spectroscopy (NMR). The results obtained by MS showed that the ESI-MS mass spectra of both HPLC column fractions, e.g. peak 1 and peak 2, are essentially equal, showing that both isomers display nearly identical gas-phase behavior with clusters of isotopologue ions centered at m/z 573, m/z 543 and m/z 513. Regarding the NMR analysis, the results showed that the positional isomerism is located in the bdqi-COOH ligand. From the observed results it can be concluded that the synthesis procedure that has been used results in the formation of two [Ru(terpy)(bdqi-COOH)NO](PF(6))(3) isomers. (c) 2009 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objective: To describe a new syndrome of X-linked myoclonic epilepsy with generalized spasticity and intellectual disability (XMESID) and identify the gene defect underlying this disorder. Methods: The authors studied a family in which six boys over two generations had intractable seizures using a validated seizure questionnaire, clinical examination, and EEG studies. Previous records and investigations were obtained. Information on seizure disorders was obtained on 271 members of the extended family. Molecular genetic analysis included linkage studies and mutational analysis using a positional candidate gene approach. Results: All six affected boys had myoclonic seizures and TCS; two had infantile spasms, but only one had hypsarrhythmia. EEG studies show diffuse background slowing with slow generalized spike wave activity. All affected boys had moderate to profound intellectual disability. Hyperreflexia was observed in obligate carrier women. A late-onset progressive spastic ataxia in the matriarch raises the possibility of late clinical manifestations in obligate carriers. The disorder was mapped to Xp11.2-22.2 with a maximum lod score of 1.8. As recently reported, a missense mutation (1058C>T/P353L) was identified within the homeodomain of the novel human Aristaless related homeobox gene (ARX). Conclusions: XMESID is a rare X-linked recessive myoclonic epilepsy with spasticity and intellectual disability in boys. Hyperreflexia is found in carrier women. XMESID is associated with a missense mutation in ARX. This disorder is allelic with X-linked infantile spasms (ISSX; MIM 308350) where polyalanine tract expansions are the commonly observed molecular defect. Mutations of ARX are associated with a wide range of phenotypes; functional studies in the future may lend insights to the neurobiology of myoclonic seizures and infantile spasms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background An increased risk of choking associated with antipsychotic medication has been repeatedly postulated. Aims To examine this association in a large number of cases of choking deaths. Method Cases of individuals who had died because of choking were linked with a case register recording contacts with public mental health services. The actual and expected rates of psychiatric disorder and the presence of psychotropic medication in post-mortem blood samples were compared. Results The 70 people who had choked to death were over 20 times more likely to have been treated previously for schizophrenia. They were also more likely to have had a prior organic psychiatric syndrome. The risk for those receiving thioridazine or lithium was. respectively, 92 times and 30 times greater than expected. Other antipsychotic and psychotropic drugs were not over-represented. Conclusions The increased risk of death in people with schizophrenia may be a combination of inherent predispositions and the use of specific antipsychotic drugs. The increased risk of choking in those with organic psychiatric syndromes is consistent with the consequences of compromised neurological competence. Declaration of interest None.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A partially occluded contour and a slanted contour may generate identical binocular horizontal disparities. We investigated conditions promoting an occlusion resolution indicated by an illusory contour in depth along the aligned ends of horizontally disparate line sets. For a set of identical oblique lines with a constant width added to one eye's view, strength, depth, and stability of the illusory contour were poor, whereas for oblique lines of alternating orientations the illusory contours were strong, indicating a reliance on vertical size disparities rather than vertical positional disparities in generating perceived occlusion. For horizontal lines, occlusion was seen when the lines were of different lengths and absolute width disparity was invariant across the set. In all line configurations, when the additional length was on the wrong eye to be attributed to differential occlusion, lines appeared slanted consistent with their individual horizontal disparities. This rules out monocular illusory contours as the determining factor.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In immediate fire deaths, pulmonary injury may be the main source of mortality, being important to document the histologic findings for the purpose of excluding other modes of death, such as from asphyxia with no gross findings. In this context, a group of morphologic determinants have been targeted with useful makers of pulmonary injury. To facilitate the determination of whether an individual was deceased before the start of a fire and validate the importance of parenchymal alterations in pulmonary injury in fire deaths, we studied lungs in victims of fire (N = 28) and suffocation (N = 40), creating a mathematical model using cluster analysis. For this purpose, a semiquantitative analysis of the distal parenchyma was performed to evaluate the amount of bronchiolar dilatation, overinsufflation (ductal and alveolar), collapse (ductal and alveolar), passive congestion, alveolar edema, and hemorrhage (interstitial and alveolar). These 7 histologic determinants were useful to discriminate fire (bronchiolar dilatation, ductal overinsuflation, alveolar overinsuflation, alveolar hemorrhage) from suffocation lung injuries (alveolar collapse, congestion, and edema). We conclude that these determinants should be included in the routine of forensic pathology.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We studied the anisotropic aggregation of spherical latex particles dispersed in a lyotropic liquid crystal presenting three nematic phases; calamitic, biaxial, and discotic. We observed that in the nematic calamitic phase aggregates of latex particles are formed, which become larger and anisotropic in the vicinity of the transition to the discotic phase, due to a coalescence process. Such aggregates are weakly anisotropic and up to 50 mu m long and tend to align parallel to the director field. At the transition to the discotic phase, the aggregates dissociated and re-formed when the system was brought back to the calamitic phase. This shows that the aggregation is due to attractive and repulsive forces generated by the particular structure of the nematic phase. The surface-induced positional order was investigated by surface force apparatus experiments with the lyotropic system confined between mica surfaces, revealing the existence of a presmectic wetting layer around the surfaces and oscillating forces of increasing amplitude as the confinement thickness was decreased. We discuss the possible mechanisms responsible for the reversible aggregation of latex particles, and we propose that capillary condensation of the N(C) phase, induced by the confinement between the particles, could reduce or remove the gradient of order parameter, driving the transition of aggregates from solidlike to liquidlike and gaslike.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Benign Paroxysmal Positional Vertigo is the most common peripheral vestibular disorder, especially in the elderly and presents as the predominant etiology in this population of the degeneration of the utricular macula. Aim: To compare the effectiveness of the approaches after Epley maneuver. Study Design: longitudinal cohort. Materials and Methods: The study included 53 volunteers with Benign Paroxysmal Positional Vertigo of the posterior semicircular canal, divided into Group 1, who underwent Epley maneuver associated with the use of neck collar and post-maneuver instructions, Group 2 underwent the Epley maneuver without the use cervical collar and/or post-maneuver restrictions, and Group 3 underwent the Epley maneuver associated with the use of a mini vibrator, without the use of neck collar and/or post-maneuver restrictions. Results: In the three groups, the number of Epley maneuvers ranged from one to three. We employed the Brazilian Dizziness Handicap Inventory - pre- and post-treatment and observed a statistically significant difference on most scores pre- and post-treatment for both groups. Conclusion: Regardless of the post Epley maneuver treatment selected for the treatment of Benign Paroxysmal Positional Vertigo, it was effective when comparing the Brazilian Dizziness Handicap Inventory pre- and post-treatment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Purpose: Hemiplegic shoulder pain can affect up to 70% of stroke patients and can have an adverse impact on rehabilitation outcomes. This article aims to review the literature on the suggested causes of hemiplegic shoulder pain and the therapeutic techniques that can be used to prevent or treat it. On the basis of this review, the components of an optimal management programme for hemiplegic shoulder pain are explored. Method: English language articles in the CINAHL and MEDLINE databases between 1990 and 2000 were reviewed. These were supplemented by citation tracking and manual searches. Results: A management programme for hemiplegic shoulder pain could comprise the following components: provision of an external support for the affected upper limb when the patient is seated, careful positioning in bed, daily static positional stretches, motor retraining and strapping of the scapula to maintain postural tone and symmetry. Conclusions: Research is required to evaluate the effectiveness of the components of the proposed management programme for the prevention and treatment of hemiplegic shoulder pain and to determine in what combination they achieve the best outcomes.