Detection and differentiation of Leptospira spp. serovars in bovine semen by polymerase chain reaction and restriction fragment length polymorphism

In view of the importance of venereal transmission of bovine leptospirosis, the objective of the present study was to apply the polymerase chain reaction (PCR) to 26 serovars of Leptospira interrogans, L. borgpetersenii, L. santarosai, L. noguchii and L. biflexa, to determine the detection threshold in semen samples and to evaluate the possibility of differentiation among serovars using 19 restriction endonucleases. The results showed that all serovars were amplified and the detection threshold in semen samples of a bull was 100 bacteria/ml. Using endonucleases we could classify the 26 serovars into eight groups. The present results show that PCR is a method of great potential for the detection of Leptospira spp, at bovine artificial insemination centers. (C) 2000 Elsevier B.V. B.V. All rights reserved.

A new polymerase chain reaction/restriction fragment length polymorphism protocol for Plasmodium vivax circumsporozoite protein genotype (VK210, VK247, and P-vivax-like) determination

For the molecular diagnosis of Plasmodium vivax variants (VK210, VK247, and P. vivax-like) using DNA amplification procedures in the laboratory, the choice of rapid and inexpensive identification products of the 3 different genotypes is an important prerequisite. We report here the standardization of a new polymerase chain reaction/restriction fragment length polymorphism technique to identify the 3 described P. vivax circumsporozoite protein (CSP) variants using amplification of the central immunodominant region of the CSP gene of this protozoan. The simplicity, specificity, and sensitivity of the system described here is important to determine the prevalence and the distribution of infection with these P. vivax genotypes in endemic and nonendemic malaria areas, enabling a better understanding of their phylogeny. (c) 2007 Published by Elsevier B.V.

FISH using a gag-like fragment probe reveals a common Ty3-gypsy-like retrotransposon in genome of Coffea species

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Genetic diversity in wild (Sus scrofa scrofa) and domestic (Sus scrofa domestica) pigs and their hybrids based on polymorphism of a fragment of the D-loop region in the mitochondrial DNA

We examined the variation in mitochondrial DNA by sequencing the D-loop region in wild and domestic (large-white breed) pigs, in hybrids between domestic and wild pigs, and in Monteiro pigs. A D-loop fragment of approximately 330 bp was amplified by PCR. Sequencing of DNA amplicons identified haplotypes previously described as European and Asian types. Monteiro pigs and wild pigs had European haplotypes and domestic pigs had both European and Asian haplotypes. ©FUNPEC-RP.

Assessing genetic variability in bat species of Emballonuridae, Phyllostomidae, Vespertilionidae and Molossidae families (Chiroptera) by RFLP-PCR

A PCR-RFLP analysis of the restriction pattern in nuclear (RAG2) and mitochondrial (12S/16S) gene sequences of bat species from the Molossidae, Phyllostomidae, Vespertilionidae, and Emballonuridae families produced a large number of fragments: 107 for RAG2 and 155 for 12S/16S combined in 139 and 402 haplotypes, respectively. The values detected for gene variation were low for both sequences (0.13 for RAG2 and 0.15 for 12S/16S) and reflected their conservative feature, reinforced by high values of inter- and intraspecies genetic identity (70-100%). The species with a high gene divergence were variable in the analyses of RAG2 (Eumops perotis, Artibeus lituratus, and Carollia perspicillata) and of 12S/16S (Nyctinomops laticaudatus, C. perspicillata, and Cynomops abrasus), and furthermore, one of them, C. perspicillata, also showed the highest intraspecific variation. The species that exhibited the lowest variation for both genes was Molossus rufus. In the families, the highest variation was observed in the Molossidae and this can be attributed to variation exhibited by Eumops and Nyctinomops species. The variations observed were interpreted as a natural variability within the species and genus that exhibited a conserved pattern in the two gene sequences in different species and family analyzed. Our data reinforce the idea that the analyses of mitochondrial and nuclear genes contribute to our knowledge of the diversity of New World bats. The genetic variability found in different taxa suggests that an additional diversity, unnoticed by other methods, can be revealed with the use of different molecular strategies. ©FUNPEC-RP.

Multiplex PCR use for Staphylococcus aureus identification and oxacillin and mupirocin resistance evaluation

Oxacillin-resistant Staphylococcus aureus represents a serious problem in hospitals worldwide, increasing infected patients' mortality and morbidity and raising treatment costs and internment time. In this study, the results of using the Multiplex PCR technique to amplify fragments of the genes femA (specific-species), mecA (oxacillin resistance) and ileS-2 (mupirocin resistance) were compared with those of tests conventionally used to identify S. aureus isolates and ascertain their resistance to drugs. Fifty S. aureus strains were isolated from patients receiving treatment at UNOESTE University Hospital in Presidente Prudente, SP, Brazil. The 686 bp fragment corresponding to the gene femA was amplified and detected in all the isolates. On the other hand, the 310 bp fragment corresponding to the mecA gene was amplified in 29 (58%) of the isolates. All of the isolates showed sensitivity to mupirocin in the agar diffusion test, which was corroborated by the lack of any amplicon of the 456 bp fragment corresponding to the ileS-2 gene, in the PCR bands. The conventional tests to identify S. aureus and detect resistance to oxacillin and mupirocin showed 100% agreement with the PCR Multiplex results. The use of techniques for rapid and accurate identification of bacteria and assessment of their resistance may be valuable in the control of infection by resistant strains, allowing the rapid isolation and treatment of an infected patient. However, the results demonstrate that traditional phenotypic tests are also reliable, though they take more time.

A PCR/RFLP methodology to identify non-Amazonian Brazilian deer species

Due to the necessity of using noninvasive samples to study animals as elusive as the deer that occur in Brazil, we realized it was important to develop a PCR/RFLP protocol to assist in identifying such samples. Thus we developed a protocol in which a fragment of the cytochrome b gene is digested with two enzymes: SspI, which distinguishes species of the genus Mazama from Blastocerus dichotomus and Ozotoceros bezoarticus, and TAQα1 which permits differentiation between the species B. dichotomus and O. bezoarticus. © 2013 Springer Science+Business Media Dordrecht.

Extração de DNA de material de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR)

Pós-graduação em Fisiopatologia em Clínica Médica - FMB

Detecção e diferenciação do vírus da bronquite infecciosa pela técnica de imunocaptura-RT-PCR E RFLP

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Nested-PCR do gene que codifica o antígeno b aplicada ao diagnóstico da tuberculose pulmonar

A reação em cadeia da polimerase usada para amplificação de uma seqüência interna de um fragmento previamente amplificado (nested-PCR) foi investigada como uma alternativa complementar a pesquisa de bacilos álcool ácido resistentes e a cultura do Mycobacterium tuberculosis em meio de Lowenstein-Jensen. Foram investigadas 144 amostras de escarro de pacientes suspeitos de tuberculose encaminhados ao Laboratório de Tuberculose do Instituto Evandro Chagas em Belém, no período de junho de 2002 a dezembro de 2003. Das 144 amostras, 121 foram caracterizadas como tuberculose, 119 foram positivas na cultura, 95 na baciloscopia e 128 na nested-PCR. A sensibilidade da nested-PCR foi 96% (116/121), enquanto a especificidade foi 48% (11/23). A nested-PCR poderá ser uma ferramenta complementar para o diagnóstico da tuberculose, pois apresenta sensibilidade equivalente à cultura, no entanto, necessita de maiores avaliações visando minimizar o número de resultados falso-positivos.

Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb)gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

The detection of Cryptosporidium serpentis in snake fecal samples by real-time PCR

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)