Dinâmica de interações intraguilda em Chrysoperla externa (Neuroptera: Chrysopidae), Harmonia axyridis (Coleoptera: Coccinellidae) com Diaphorina citri (Hemiptera: Psyllidae)

A necessidade por recursos alimentares move os insetos predadores na busca por presas, para garantir a sobrevivência. Existem vários fatores que podem influenciar o comportamento de busca e escolha por presas e, sob determinadas circunstâncias, o inseto pode escolher se alimentar de presas não alvo, como, por exemplo, inimigos naturais e assim prejudicar a população de organismos benéficos. Garantir a estabilidade do agroecossistema é uma forma de manter as populações de pragas em níveis compatíveis com a ação de inimigos naturais e, consequentemente obter o sucesso no controle biológico. Programas bem sucedidos de manejo de pragas requerem previamente a realização de estudos sobre comportamento de insetos. Com o intuito de compreender os fatores que governam o comportamento predatório e as interações ecológicas entre Harmonia axyridis e Chrysoperla externa, considerando a presença de Diaphorina citri como presa, objetivou-se estudar o efeito de interações intraguilda sobre a predação de D. citri, experimentalmente e utilizando modelos estatísticos para compreender a dinâmica de interações tróficas no contexto de potenciais guildas presentes em citros. Três experimentos distintos foram realizados para investigar o comportamento dos insetos predadores. Foram realizados testes com escolha entre larvas dos predadores C. externa e H. axyridis e testes com e sem escolha comparando machos e fêmeas do predador H. axyridis, a fim de investigar padrões de escolha de presas. O segundo experimento foi realizado para investigar o comportamento predatório entre larvas de segundo instar dos predadores sob diferentes densidades de D. citri como presa. As combinações foram: sem escolha de presas intraguilda, combinações com escolha de presas intraguilda e combinações com a presença de dois predadores da mesma espécie para possibilitar o canibalismo. As densidades de D. citri utilizadas foram 5, 10, 15, 30, 60, 80. No último experimento avaliou-se a interação entre larvas de C. externa e H. axyridis, ao longo do desenvolvimento, simulando a existência de apenas uma presa, como fonte de alimento. O desenvolvimento dos predadores foi avaliado e comparado utilizando-se duas presas diferentes, ninfas de D. citri e ovos de Ephestia kuehniella para cada larva de primeiro instar dos predadores C. externa e H. axyridis. As combinações de predadores foram as mesmas citadas no experimento anterior. Observou-se a duração do desenvolvimento larval nas diferentes combinações de predadores e presa, bem como o percentual de predações intraguilda e canibalismos ocorridos. Nem a densidade de presas, nem o tipo de presa ofertada influenciou o comportamento das larvas dos predadores para a realização de predação intraguilda ou canibalismo. O principal fator foi a diferença de idade que reflete no tamanho dos predadores, podendo direcionar a predação intraguilda ou o canibalismo e até mesmo acelerar o ciclo de desenvolvimento do predador intraguilda envolvido. Predadores em estágio inicial de vida buscaram por qualquer tipo de presa para garantir sua sobrevivência, não demonstrando qualquer padrão em suas escolhas. No caso dos adultos de H. axyridis, há diferença de comportamento entre os sexos, dependendo da densidade de presas disponíveis, fêmeas poderão ser mais ágeis na busca e consumo de presas.

The effect of larval age on morphology and gene expression during ascidian metamorphosis

Metamorphosis is both an ecological and a developmental genetic transition that an organism undergoes as a normal part of ontogeny. Many organisms have the ability to delay metamorphosis when conditions are unsuitable. This strategy carries obvious benefits, but may also result in severe consequences for older larvae that run low on energy. In the marine environment, some lecithotrophic larvae that have prolonged periods in the plankton may begin forming postlarval and juvenile structures that normally do not appear until after settlement and the initiation of metamorphosis. This precocious activation of the postlarval developmental program may reflect an adaptation to increase the survival of older, energy-depleted larvae by allowing them to metamorphose more quickly. In the present study, we investigate morphological and genetic consequences of delay of metamorphosis in larvae of Herdmania momus (a solitary stolidobranch ascidian). We observe significant morphological and genetic changes during prolonged larval life, with older larvae displaying significant changes in RNA levels, precocious migration of mesenchyme cells, and changes in larval shape including shortening of the tail. While these observations suggest that the older H. momus larvae are functionally different from younger larvae and possibly becoming more predisposed to undergo metamorphosis, we did not find any significant differences in gene expression levels between postlarvae arising from larvae that metamorphosed as soon as they were competent and postlarvae developing from larvae that postponed metamorphosis. This recalibration, or convergence, of transcript levels in the early postlarva suggests that changes that occur during prolonged larval life of H. momus are not necessarily associated with early activation of adult organ differentiation. Instead, it suggests that an autonomous developmental program is activated in H. momus upon the induction of metamorphosis regardless of the history of the larva.

A systematic review of evidence for silver nanoparticle-induced mitochondrial toxicity

© The Royal Society of Chemistry 2016.Silver nanoparticles (AgNPs) are extensively used for their antibacterial properties in a diverse set of applications, ranging from the treatment of municipal wastewater to infection control in hospitals. However, the properties of AgNPs that render them conducive to bactericidal use in commerce may influence their potential toxicity to non-bacterial organisms. Based on the physiological and phylogenetic similarities between bacteria and mitochondria within eukaryotic cells, mitochondria are a likely intracellular target of AgNP toxicity. Mitochondria-specific outcomes of AgNP exposures have been identified in multiple cell types, including (but not limited to) loss of membrane potential, inhibition of enzymes involved in oxidative phosphorylation, and changes in calcium sequestration. However, the biological significance of mitochondrial toxicity due to AgNP exposure is currently incompletely understood. This review examines the existing evidence of mitochondrial toxicity induced by AgNP exposure, with discussions of the role of the physicochemical properties of the nanoparticles themselves in mitochondrial toxicity. The impacts of potentially differential cell- and tissue-specific significance of AgNP-induced mitochondrial dysfunction are also discussed.

Fluorine-18-labeled estrogens, progestins and corticosteroids for receptor-based imaging of breast tumors and target areas of the brain

Estrogens can be labeled with the positron-emitting radionuclide fluorine-18 (t$\sb{1/2}$ = 110 min) by fluoride ion (n-Bu$\sb4$N$\sp{18}$F) displacement of a 16$\beta$-trifluoromethanesulfonate (triflate) derivative of the corresponding estrone 3-triflate, and purification by HPLC. That sequence has been used to synthesize the 11$\beta$-methoxy 1 and 11$\beta$-ethyl 2 analogues of the breast tumor imaging agent, 16$\alpha$-($\sp{18}$F) fluoro-17$\beta$-estradiol (FES). Tissue distribution studies of 1 and 2 in immature female rats show high selectivity for target tissue (T, uterus) vs non-target (NT, muscle and lung), with T/NT ratios being 43 and 17 at one hour after injection for 1 and 2, respectively. The parent estrogen FES has previously been shown to display an intermediate value for tissue selectivity.

Sulfetos volatilizáveis por acidificação e metais extraídos simultaneamente na avaliação de sedimentos de água doce

This paper discusses the historical and methodological fundaments of the dynamics and quantification of acid volatile sulfides (AVS) and simultaneously extracted metals (SEM) in aquatic sediments. It also discusses the SEM/AVS relationship, which involves several controversial aspects such as sulfide stability, sulfide-organic matter interaction, and the inability to predict the toxicity of organic compounds in the environment. This relationship is an important tool for the inference of metal bioavailability. The use of ecotoxicological tests with target organisms regulated by international standards is also a relevant aspect.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Fungal pathogens as classical biological control agents against arthropods

Fungal entomopathogens have been used more frequently than other types of pathogens for classical biological control. Among 136 programs using different groups of arthropod pathogens, 49.3% have introduced fungal pathogens (including both the traditional fungi and microsporidia). The most commonly introduced species was Metarhizium anisopliae (Metschnikoff) Sorokin, with 13 introductions, followed by Entomophaga maimaiga Humber, Shimazu & Soper, which was released seven times. The majority of introduction programs have focused on controlling invasive species of insects or mites (70.7%) rather than on native hosts (29.4%). Almost half of the introductions of traditional fungi targeted species of Hemiptera and 75% of the microsporidia introduced have been introduced against lepidopteran species. The United States was the country where most introductions of fungi took place (n = 24). From 1993 to 2007, no arthropod pathogens were released in the US due to the rigorous regulatory structure, but in 2008 two species of microsporidia were introduced against the gypsy moth, Lymantria dispar (L.). Establishment of entomopathogenic fungi in programs introducing traditional fungi was 32.1% and establishment was 50.0% for programs introducing microsporidia. In some programs, releases have resulted in permanent successful establishment with no non-target effects. In summary, classical biological control using fungal entomopathogens can provide a successful and environmentally friendly avenue for controlling arthropod pests, including the increasing numbers of invasive non-native species.

Chimeric 16S rDNA sequences of diverse origin are accumulating in the public databases

A significant number of chimeric 16S rDNA sequences of diverse origin were identified in the public databases by partial treeing analysis. This suggests that chimeric sequences, representing phylogenetically novel non-existent organisms, are routinely being overlooked in molecular phylogenetic surveys despite a general awareness of PCR-generated artefacts amongst researchers.