966 resultados para IMPAIRS ENDOCYTOSIS


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Schizophrenia pathophysiology implies both abnormal redox control and dysconnectivity of the prefrontal cortex, partly related to oligodendrocyte and myelin impairments. As oligodendrocytes are highly vulnerable to altered redox state, we investigated the interplay between glutathione and myelin. In control subjects, multimodal brain imaging revealed a positive association between medial prefrontal glutathione levels and both white matter integrity and resting-state functional connectivity along the cingulum bundle. In early psychosis patients, only white matter integrity was correlated with glutathione levels. On the other side, in the prefrontal cortex of peripubertal mice with genetically impaired glutathione synthesis, mature oligodendrocyte numbers, as well as myelin markers, were decreased. At the molecular levels, under glutathione-deficit conditions induced by short hairpin RNA targeting the key glutathione synthesis enzyme, oligodendrocyte progenitors showed a decreased proliferation mediated by an upregulation of Fyn kinase activity, reversed by either the antioxidant N-acetylcysteine or Fyn kinase inhibitors. In addition, oligodendrocyte maturation was impaired. Interestingly, the regulation of Fyn mRNA and protein expression was also impaired in fibroblasts of patients deficient in glutathione synthesis. Thus, glutathione and redox regulation have a critical role in myelination processes and white matter maturation in the prefrontal cortex of rodent and human, a mechanism potentially disrupted in schizophrenia.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Obesity is associated with chronic food intake disorders and binge eating. Food intake relies on the interaction between homeostatic regulation and hedonic signals among which, olfaction is a major sensory determinant. However, its potential modulation at the peripheral level by a chronic energy imbalance associated to obese status remains a matter of debate. We further investigated the olfactory function in a rodent model relevant to the situation encountered in obese humans, where genetic susceptibility is juxtaposed on chronic eating disorders. Using several olfactory-driven tests, we compared the behaviors of obesity-prone Sprague-Dawley rats (OP) fed with a high-fat/high-sugar diet with those of obese-resistant ones fed with normal chow. In OP rats, we reported 1) decreased odor threshold, but 2) poor olfactory performances, associated with learning/memory deficits, 3) decreased influence of fasting, and 4) impaired insulin control on food seeking behavior. Associated with these behavioral modifications, we found a modulation of metabolism-related factors implicated in 1) electrical olfactory signal regulation (insulin receptor), 2) cellular dynamics (glucorticoids receptors, pro- and antiapoptotic factors), and 3) homeostasis of the olfactory mucosa and bulb (monocarboxylate and glucose transporters). Such impairments might participate to the perturbed daily food intake pattern that we observed in obese animals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The occurrence of cognitive disturbances upon CNS inflammation or infection has been correlated with increased levels of the cytokine tumor necrosis factor-α (TNFα). To date, however, no specific mechanism via which this cytokine could alter cognitive circuits has been demonstrated. Here, we show that local increase of TNFα in the hippocampal dentate gyrus activates astrocyte TNF receptor type 1 (TNFR1), which in turn triggers an astrocyte-neuron signaling cascade that results in persistent functional modification of hippocampal excitatory synapses. Astrocytic TNFR1 signaling is necessary for the hippocampal synaptic alteration and contextual learning-memory impairment observed in experimental autoimmune encephalitis (EAE), an animal model of multiple sclerosis (MS). This process may contribute to the pathogenesis of cognitive disturbances in MS, as well as in other CNS conditions accompanied by inflammatory states or infections.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Fatigue is likely to be an important limiting factor in adolescents with spastic cerebral palsy (CP). AIMS: To determine the effects of walking-induced fatigue on postural control adjustments in adolescents with unilateral CP and their typically developing (TD) peers. METHODS: Ten adolescents with CP (14.2±1.7yr) and 10 age-, weight- and height-matched TD adolescents (14.1±1.9yr) walked for 15min on a treadmill at their preferred walking speed. Before and after this task, voluntary strength capacity of knee extensors (MVC) and postural control were evaluated in 3 conditions: eyes open (EO), eyes closed (EC) and with dual cognitive task (EODT). RESULTS: After walking, MVC decreased significantly in CP (-11%, P<0.05) but not in TD. The CoP area was only significantly increased in CP (90%, 34% and 60% for EO, EC and EODT conditions, respectively). The CoP length was significantly increased in the EO condition in CP and TD (20% and 21%) and was significantly increased in the EODT condition by 18% in CP only. CONCLUSIONS: Unlike TD adolescents, treadmill walking for 15min at their preferred speed lead to significant knee extensor strength losses and impairments in postural control in adolescents with unilateral spastic CP.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coxsackievirus A9 (CV-A9) belongs to human enteroviruses within family Picornaviridae, which are the main cause of aseptic meningitis. In addition, CV-A9 causes a wide range of other clinical manifestations of acute disease including respiratory infections, myocarditis, encephalitis and severe generalized infections in newborns. In this study, the functions of integrins αVβ6 and αVβ3 in the attachment and cellular entry of CV-A9 were analyzed. Further, virus and cell surface interactions and endocytosis of CV-A9 were studied in specific cell lines. Also, a method for production of GFP-expressing CV-A9 particles by long PCR-mediated mutagenesis and in vivo transcription was developed. The results indicated that RGD-motif (arginine-glycine-asparagine) that resides in the viral capsid is important for CV-A9 infection particularly in cell lines expressing integrin αVβ6 and that this integrin serves as a high affinity attachment receptor for the virus. CV-A9 is also capable of infecting certain cell lines independently of αV-integrins by binding to the cell surface HSPA5 protein. Regardless of the attachment stage, the internalization of the virus occurs via the same entry pathway and is dependent on β2M, dynamin, and Arf6 but independent of clathrin and caveolin-1. Furthermore, the virus internalization occurs within Arf6-containing vesicles suggesting that Arf6 is central mediator of CV-A9 endocytosis. While in this study the results of CV-A9 endocytosis were based on microscopical visualization within individual fixed cells, a rapid method for generation of a virus for real-time imaging was also described.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Calcium oxalate (CaOx) crystals adhere to and are internalized by tubular renal cells and it seems that this interaction is related (positively or negatively) to the appearance of urinary calculi. The present study analyzes a series of mechanisms possibly involved in CaOx uptake by Madin-Darby canine kidney (MDCK) cells. CaOx crystals were added to MDCK cell cultures and endocytosis was evaluated by polarized light microscopy. This process was inhibited by an increase in intracellular calcium by means of ionomycin (100 nM; N = 6; 43.9% inhibition; P<0.001) or thapsigargin (1 µM; N = 6; 33.3% inhibition; P<0.005) administration, and via blockade of cytoskeleton assembly by the addition of colchicine (10 µM; N = 8; 46.1% inhibition; P<0.001) or cytochalasin B (10 µM; N = 8; 34.2% inhibition; P<0.001). Furthermore, CaOx uptake was reduced when the activity of protein kinase C was inhibited by staurosporine (10 nM; N = 6; 44% inhibition; P<0.01), or that of cyclo-oxygenase by indomethacin (3 µM; N = 12; 17.2% inhibition; P<0.05); however, the uptake was unaffected by modulation of potassium channel activity with glibenclamide (3 µM; N = 6), tetraethylammonium (1 mM; N = 6) or cromakalim (1 µM; N = 6). Taken together, these data indicate that the process of CaOx internalization by renal tubular cells is similar to the endocytosis reported for other systems. These findings may be relevant to cellular phenomena involved in early stages of the formation of renal stones.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A construct (AT1R-NF) containing a "Flag" sequence added to the N-terminus of the rat AT1 receptor was stably expressed in Chinese hamster ovary cells and quantified in the cell membrane by confocal microscopy after reaction with a fluorescein-labeled anti-Flag monoclonal antibody. Angiotensin II bound to AT1R-NF and induced endocytosis with a half-time of 2 min. After 60-90 min, fluorescence accumulated around the cell nucleus, suggesting migration of the ligand-receptor complex to the nuclear membrane. Angiotensin antagonists also induced endocytosis, suggesting that a common step in the transduction signal mechanism occurring after ligand binding may be responsible for the ligand-receptor complex internalization.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The precise nature of hormones and growth factors directly responsible for cartilage maturation is still largely unclear. Since longitudinal bone growth occurs through endochondral bone formation, excess or deficiency of most hormones and growth factors strongly influences final adult height. The structure and composition of the cartilaginous extracellular matrix have a critical role in regulating the behavior of growth plate chondrocytes. Therefore, the maintenance of the three-dimensional cell-matrix interaction is necessary to study the influence of individual signaling molecules on chondrogenesis, cartilage maturation and calcification. To investigate the effects of insulin on both proliferation and induction of hypertrophy in chondrocytes in vitro we used high-density micromass cultures of chick embryonic limb mesenchymal cells. Culture medium was supplemented with 1% FCS + 60 ng/ml (0.01 µM) insulin and cultures were harvested at regular time points for later analysis. Proliferating cell nuclear antigen immunoreactivity was widely detected in insulin-treated cultures and persisted until day 21 and [³H]-thymidine uptake was highest on day 14. While apoptosis increased in control cultures as a function of culture time, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-labeled cells were markedly reduced in the presence of insulin. Type II collagen production, alkaline phosphatase activity and cell size were also lower in insulin-treated cultures. Our results indicate that under the influence of 60 ng/ml insulin, chick chondrocytes maintain their proliferative potential but do not become hypertrophic, suggesting that insulin can affect the regulation of chondrocyte maturation and hypertrophy, possibly through an antiapoptotic effect.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We determined the effect of an H1 receptor antagonist on the functional recovery of Carassius auratus submitted to telencephalic ablation. Five days after surgery the fish underwent a spatial-choice learning paradigm test. The fish, weighing 6-12 g, were divided into four groups: telencephalic ablation (A) or sham lesion (S) and saline (SAL) or chlorpheniramine (CPA, ip, 16 mg/kg). For eight consecutive days each animal was trained individually in sessions separated by 24 h (alternate days). Training trials (T1-T8) consisted of finding the food in one of the feeders, which were randomly blocked for each subject. Animals received an intraperitoneal injection of SAL or CPA 10 min after the training trials. The time spent by the animals in each group to find the food (latency) was analyzed separately at T1 and T8 by the Kruskal-Wallis test, followed by the Student Newman-Keuls test. At T1 the latencies (mean ± SEM) of the A-SAL (586.3 ± 13.6) and A-CPA (600 ± 0) groups were significantly longer than those of the S-SAL (226.14 ± 61.15) and S-CPA (356.33 ± 68.8) groups. At T8, the latencies of the A-CPA group (510.11 ± 62.2) remained higher than those of the other groups, all of which showed significantly shorter latencies (A-SAL = 301.91 ± 78.32; S-CPA = 191.58 ± 73.03; S-SAL = 90.28 ± 41) compared with T1. These results support evidence that training can lead to functional recovery of spatial-choice learning in telencephalonless fish and also that the antagonist of the H1 receptor impairs it.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study investigated the effect of thioperamide (THIO), an H3 histaminergic receptor antagonist, microinjected into the cerebellar vermis on emotional memory consolidation in male Swiss albino mice re-exposed to the elevated plus-maze (EPM). We implanted a guide cannula into the cerebellar vermis using stereotactic surgery. On the third day after surgery, we performed behavioral tests for two consecutive days. On the first day (exposure), the mice (n=10/group) were exposed to the EPM and received THIO (0.06, 0.3, or 1.5 ng/0.1 µL) immediately after the end of the session. Twenty-four hours later, the mice were re-exposed to the EPM under the same experimental conditions, but without drug injection. A reduction in the exploration of the open arms upon re-exposure to the EPM (percentage of number of entries and time spent in open arms) compared with the initial exposure was used as an indicator of learning and memory. One-way analysis of variance (ANOVA) followed by the Duncan post hoc test was used to analyze the data. Upon re-exposure, exploratory activity in the open arms was reduced in the control group, and with the two highest THIO doses: 0.3 and 1.5 ng/0.1 µL. No reduction was seen with the lowest THIO dose (0.06 ng/0.1 µL), indicating inhibition of the consolidation of emotional memory. None of the doses interfered with the animals' locomotor activity. We conclude that THIO at the lowest dose (0.06 ng/0.1 µL) microinjected into the cerebellum impaired emotional memory consolidation in mice.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Au cours de l’ovogenèse chez la mouche du vinaigre: Drosophila melanogaster, un groupe de cellules folliculaires appelées cellules de bord, migrent à travers les cellules nourricières pour atteindre l’ovocyte. Cet événement, nécessitant la transition épithélio- mésenchymateuse (TEM), la réorientation, puis l’arrêt, ressemble à la formation de métastases. L’endocytose est un régulateur clé de plusieurs événements polarisés, y compris la migration cellulaire. En effet, différentes protéines impliquées dans la migration, comme les intégrines et les E-cadhérines (cadhérines épithéliales), sont régulées par transport à travers les endosomes. De même, l’endocytose restreint au front de migration l’activité des récepteurs tyrosine kinases (RTKs) qui guident les cellules de bord dans leur mouvement. Cependant les mécanismes moléculaires de cette restriction spatiale de l’activité des RTKs demeurent largement inconnus. Nous avons testé l’implication du trafic vésiculaire à travers la machinerie d’endocytose, dans la migration dirigée des cellules de bord, car ce système est facilement accessible pour l’expression de protéines et l’analyse de mutants. Nous avons commencé par confirmer une observation précédente du rôle de l’endosome précoce dans la migration des cellules de bord. Ensuite, nous avons identifié l’endosome de recyclage (ER) comme un régulateur clé de cette migration. En effet, nous avons démontré que l’expression dans les cellules de bord d’une forme dominante négative de Rab11, la petite GTPase régulant le transport vésiculaire à travers l’ER, bloque la migration ou entraîne de sévères défauts de migration dans environ 80% des chambres d’œufs examinées. De plus, nous observons par immunofluorescence une relocalisation de l’activité des RTKs alors que d’autres protéines de migration ne sont pas affectées par Rab11 dominant négatif. Ce résultat a été par la suite confirmé par une interaction génétique entre Rab11 et les RTKs. D’autre part, nous avons montré que le complexe exocyste, un effecteur de Rab11, est impliqué dans la migration des cellules de bord. Nous avons trouvé par microscopie confocale en tissu fixé et par microscopie en temps réel que Sec15, un composant de ce complexe, est polarisé, de façon Rab11- dépendante, dans des vésicules qui s’accumulent au front de migration tout au long du mouvement des cellules de bord. De plus, la perte de l’activité de Sec15 perturbe à son tour la migration. Ainsi, toutes ces données démontrent le rôle fondamental d’un cycle d’endo- exocytose dans le maintien des RTKs actifs au niveau du front de migration des cellules de bord le long de leur mouvement.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Les calculs numériques ont été effectués à l'aide du logiciel SAGE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cereal commodities are frequently contaminated with mycotoxins produced by the secondary metabolism of fungal infection. Among these contaminants, deoxynivalenol (DON), also known as vomitoxin, is the most prevalent type B trichothecene mycotoxin worldwide. Pigs are very sensitive to the toxic effects of DON and are frequently exposed to naturally contaminated feed. Recently, DON naturally contaminated feed has been shown to decrease porcine reproductive and respiratory syndrome virus (PRRSV) specific antibody responses following experimental infection. The objective of this study was to determine the impact of DON naturally contaminated feed on the immune response generated following vaccination with PRRSV live attenuated vaccine. Eighteen pigs were randomly divided into three experimental groups of 6 animals based on DON content of the diets (0, 2.5 and 3.5 mg DON/kg). They were fed these rations one week prior to the vaccination and for all the duration of the immune response evaluation. All pigs were vaccinated intra-muscularly with one dose of Ingelvac® PRRSV modified live vaccine (MLV). Blood samples were collected at day −1, 6, 13, 20, 27 and 35 post vaccination (pv) and tested for PRRSV RNA by RT-qPCR and for virus specific antibodies by ELISA. Results showed that ingestion of DON-contaminated diets significantly decreased PRRSV viremia. All pigs fed control diet were viremic while only 1 (17%) and 3 (50%) out of 6 pigs were viremic in the groups receiving 3.5 and 2.5 mg of DON/kg, respectively. Subsequently, all pigs fed control diet developed PRRSV specific antibodies while only viremic pigs that were fed contaminated diets have developed PRRSV specific antibodies. These results suggest that feeding pigs with DON-contaminated diet could inhibit vaccination efficiency of PRRSV MLV by severely impairing viral replication.