Brain metastases in gastro-oesophageal adenocarcinoma: insights into the role of the human epidermal growth factor receptor 2 (HER2).

BACKGROUND: Gastro-oesophageal adenocarcinomas rarely metastasize to the central nervous system (CNS). The role of the human epidermal growth factor receptor 2 (HER2) in patients with these cancers and CNS involvement is presently unknown. PATIENTS AND METHODS: A multicentre registry was established to collect data from patients with gastro-oesophageal adenocarcinomas and CNS involvement both retrospectively and prospectively. Inclusion in the study required a predefined clinical data set, a central neuro-radiological or histopathological confirmation of metastatic CNS involvement and central assessment of HER2 by immunohistochemistry (IHC) and in situ hybridisation (ISH). In addition, expression of E-cadherin and DNA mismatch repair (MMR) proteins were assessed by IHC. RESULTS: One hundred patients fulfilled the inclusion criteria. The population's median age was 59 years (interquartile range: 54-68), of which 85 (85%) were male. Twenty-five patients were of Asian and 75 of Caucasian origin. HER2 status was positive in 36% (95% CI: 26.6-46.2) of cases. Median time from initial diagnosis to the development of brain metastases (BMets) or leptomeningeal carcinomatosis (LC) was 9.9 months (95% CI: 8.5-15.0). Median overall survival from diagnosis was 16.9 months (95% CI: 14.0-20.7) and was not related to the HER2 status. E-cadherin loss was observed in 9% of cases and loss of expression in at least one DNA MMR proteins in 6%. CONCLUSIONS: The proportion of a positive HER2 status in patients with gastro-oesophageal adenocarcinoma and CNS involvement was higher than expected. The impact of anti-HER2 therapies should be studied prospectively.

Bevacizumab, Pemetrexed, and Cisplatin, or Bevacizumab and Erlotinib for Patients With Advanced Non-Small-Cell Lung Cancer Stratified by Epidermal Growth Factor Receptor Mutation: Phase II Trial SAKK19/09.

OBJECTIVE: The goal was to demonstrate that tailored therapy, according to tumor histology and epidermal growth factor receptor (EGFR) mutation status, and the introduction of novel drug combinations in the treatment of advanced non-small-cell lung cancer are promising for further investigation. METHODS: We conducted a multicenter phase II trial with mandatory EGFR testing and 2 strata. Patients with EGFR wild type received 4 cycles of bevacizumab, pemetrexed, and cisplatin, followed by maintenance with bevacizumab and pemetrexed until progression. Patients with EGFR mutations received bevacizumab and erlotinib until progression. Patients had computed tomography scans every 6 weeks and repeat biopsy at progression. The primary end point was progression-free survival (PFS) ≥ 35% at 6 months in stratum EGFR wild type; 77 patients were required to reach a power of 90% with an alpha of 5%. Secondary end points were median PFS, overall survival, best overall response rate (ORR), and tolerability. Further biomarkers and biopsy at progression were also evaluated. RESULTS: A total of 77 evaluable patients with EGFR wild type received an average of 9 cycles (range, 1-25). PFS at 6 months was 45.5%, median PFS was 6.9 months, overall survival was 12.1 months, and ORR was 62%. Kirsten rat sarcoma oncogene mutations and circulating vascular endothelial growth factor negatively correlated with survival, but thymidylate synthase expression did not. A total of 20 patients with EGFR mutations received an average of 16 cycles. PFS at 6 months was 70%, median PFS was 14 months, and ORR was 70%. Biopsy at progression was safe and successful in 71% of the cases. CONCLUSIONS: Both combination therapies were promising for further studies. Biopsy at progression was feasible and will be part of future SAKK studies to investigate molecular mechanisms of resistance.

Epidermal growth factor secreted from submandibular salivary glands interferes with the lipolytic effect of adrenaline in mice

We had described that epidermal growth factor (EGF) interfered with the lipolytic effect of catecholamines in isolated adipocytes. Since catecholamines stimulate the release of EGF from submandibular salivary glands to blood plasma in male mice, we studied whether EGF affected also the lipolytic response to adrenaline in whole animals. We studied the effect of adrenaline in sialoadenectomized and sham-operated mice receiving or not a high dose of EGF following adrenaline injection. There was no difference in plasma EGF concentration between sham-operated and sialoadenectomized animals receiving saline. After adrenaline administration plasma EGF increased by 20-fold in sham-operated but did not increase in sialoadenectomized mice. Indeed, the increase was much higher (more than 100-fold) in mice receiving exogenous EGF. The effect of adrenaline on plasma concentration of both glycerol and nonesterified fatty acids was higher as lower was plasma EGF concentration. Isolated adipocytes obtained from sham-operated or sialoadenectomized mice had identical lipolytic response to adrenaline. The lipolytic response of adipocytes to isoproterenol was decreased by addition of EGF. To study whether the interference with the in vivo lipolytic effect of adrenaline had further metabolic consequences, we measured plasma b-hydroxybutyrate concentration in plasma. There was no difference in the response to adrenaline between sham-operated and sialoadenectomized mice in spite of the difference in plasma nonsterified fatty acid concentration. Studies in isolated hepatocytes indicated that ketogenesis run at near maximal rate in this range of substrate concentration. These results suggest that EGF in the physiological range decreases the lipolytic effect of adrenaline but does not compromise further metabolic events like the enhancement of ketogenesis.

Histopathology of dairy cows' hooves with signs of naturally acquired laminitis

The purpose of this study was to investigate histological changes in dairy cows' hooves with or without injuries from naturally acquired laminitis. Cull cows with no clinical signs of hoof abnormalities (G1, n=9) and those with macroscopic lesions associated with laminitis without (G2, n=23) or with lameness (G3, n=7) were used in the study. After slaughter, samples of dermo-epidermal junctions of sole, axial and dorsal regions of the hoof were obtained and histologically processed using HE and PAS staining. Congestion, hemorrhage and inflammatory infiltrate in the dermis of sole, axial and dorsal regions were blindly and semiquantitatively evaluated by the same researcher. Inflammatory infiltrate was evaluated in the dermal laminae of axial and dorsal regions. The morphology of epidermal cells and the presence of irregularities in three regions of the basement membrane (BM) length were examined using PAS staining. Scores of lesions in different regions of the hoof in the same group and in different groups for each region of the hoof were compared using non-parametric analyses. Inflammatory infiltrate in the dermis of all regions of the hoof was detected in all groups with no significant statistical difference. Cows with no clinical signs of hoof abnormalities secondary to laminitis (G1) have inflammation scores and epidermal cell changes similar to those of groups with laminitis injuries, suggesting the existence of a prodromal phase for this disease in bovines. BM had irregularities with a variable intensity along its length, however, with no difference among groups. The pattern of BM irregularities found has not been reported so far and does not resemble the BM collapse described in horses and cattle with induced acute laminitis. Is it concluded that even in the absence of macroscopic hoof signs associated to laminitis, dairy cows have histological injuries compatible with inflammation of the dermo-epidermal junction as in affected animals. Basement membrane of cows with or without laminitis associated lesions had irregularities with an irregular distribution along its length which need to be further studied.

Regulation of epidermal tight junctions by calcium ATPases and p38

The epidermis is the upper layer of the skin and keratinocytes are its most abundant cells. Tight junctions are cell junctions located in the granular layer of the epidermis. They maintain the polarity of the cells and regulate the movement of water-soluble molecules. Epidermal tight junctions may lose their integrity when there are defects in intercellular calcium regulation. Hailey-Hailey and Darier´s disease are dominantly inherited, blistering skin diseases. Hailey-Hailey disease is caused by mutations in the ATP2C1 gene encoding a calcium/manganese ATPase SPCA1 of the Golgi apparatus. Darier´s disease is caused by mutations in the ATP2A2 gene encoding a calcium ATPase SERCA2 of the endoplasmic reticulum. p38 regulates the differentiation of keratinocytes. The overall regulation of epidermal tight junctions is not well understood. The present study examined the regulation of tight junctions in the human epidermis with a focus on calcium ATPases and p38. Skin from Hailey-Hailey and Darier´s disease patients was studied by using immunofluorescence labeling which targeted intercellular junction proteins. Transepidermal water loss was also measured. ATP2C1 gene expression was silenced in cultured keratinocytes, by siRNA, which modeled Hailey-Hailey disease. Expression of intercellular junction proteins was studied at the mRNA and protein levels. Squamous cell carcinoma and normal human keratinocytes were used as a model for impaired and normal keratinocyte differentiation, and the role of p38 isoforms alpha and delta in the regulation of intercellular junction proteins was studied. Both p38 isoforms were silenced by adenovirus cell transduction, chemical inhibitors or siRNA and keratinocyte differentiation was assessed. The results of this thesis revealed that: i.) intercellular junction proteins are expressed normally in acantholytic skin areas of patients with Hailey-Hailey or Darier´s disease but the localization of ZO-1 expanded to the stratum spinosum; ii.) tight junction proteins, claudin-1 and -4, are regulated by ATP2C1 in non-differentiating keratinocytes; and iii.) p38 delta regulates the expression of tight junction protein ZO-1 in proliferating keratinocytes and in squamous cell carcinoma derived cells. ZO-1 silencing, however, did not affect the expression of other tight junction proteins, suggesting that they are differently regulated. This thesis introduces new mechanisms involved in the regulation of tight junctions revealing new interactions. It provides novel evidence linking intracellular calcium regulation and tight junctions.

Topical application of a melanotropin analogue to vulgar vitiligo dermo-epidermal minigrafts

Human subjects with active vulgar vitiligo do not respond well to autologous dermo-epidermal minigrafting. Eighteen subjects were treated with the a-melanocyte-stimulating hormone (a-MSH) synthetic analogue [Nle4, D-Phe7]-a-MSH. The hormone (50 µl, 0.4 mM) was applied topically to 30-cm2 lesions in which 29-48 minigrafts had been made. The hormone did not improve the success of the minigrafting and no differences were observed in local or distant repigmentation in treated subjects as compared to the placebo group. Aliquots of 24-h urine concentrated by lyophilization irreversibly darkened toad skins, demonstrating the presence of the analogue. This is the first report of the transdermal delivery of a topically applied melanotropin in living human subjects.

Measurement of epidermal thickness in a patient with psoriasis by computer-supported image analysis

The aim of the present study was to measure full epidermal thickness, stratum corneum thickness, rete length, dermal papilla widening and suprapapillary epidermal thickness in psoriasis patients using a light microscope and computer-supported image analysis. The data obtained were analyzed in terms of patient age, type of psoriasis, total body surface area involvement, scalp and nail involvement, duration of psoriasis, and family history of the disease. The study was conducted on 64 patients and 57 controls whose skin biopsies were examined by light microscopy. The acquired microscopic images were transferred to a computer and measurements were made using image analysis. The skin biopsies, taken from different body areas, were examined for different parameters such as epidermal, corneal and suprapapillary epidermal thickness. The most prominent increase in thickness was detected in the palmar region. Corneal thickness was more pronounced in patients with scalp involvement than in patients without scalp involvement (t = -2.651, P = 0.008). The most prominent increase in rete length was observed in the knees (median: 491 µm, t = 10.117, P = 0.000). The difference in rete length between patients with a positive and a negative family history was significant (t = -3.334, P = 0.03), being 27% greater in psoriasis patients without a family history. The differences in dermal papilla distances among patients were very small. We conclude that microscope-supported thickness measurements provide objective results.

Epidermal growth factor receptor (EGFR) mutations in lung cancer: preclinical and clinical data

Lung cancer leads cancer-related mortality worldwide. Non-small-cell lung cancer (NSCLC), the most prevalent subtype of this recalcitrant cancer, is usually diagnosed at advanced stages, and available systemic therapies are mostly palliative. The probing of the NSCLC kinome has identified numerous nonoverlapping driver genomic events, including epidermal growth factor receptor (EGFR) gene mutations. This review provides a synopsis of preclinical and clinical data on EGFR mutated NSCLC and EGFR tyrosine kinase inhibitors (TKIs). Classic somatic EGFR kinase domain mutations (such as L858R and exon 19 deletions) make tumors addicted to their signaling cascades and generate a therapeutic window for the use of ATP-mimetic EGFR TKIs. The latter inhibit these kinases and their downstream effectors, and induce apoptosis in preclinical models. The aforementioned EGFR mutations are stout predictors of response and augmentation of progression-free survival when gefitinib, erlotinib, and afatinib are used for patients with advanced NSCLC. The benefits associated with these EGFR TKIs are limited by the mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation, and bypass activation of signaling cascades. Ongoing preclinical efforts for treating resistance have started to translate into patient care (including clinical trials of the covalent EGFR-T790M TKIs AZD9291 and CO-1686) and hold promise to further boost the median survival of patients with EGFR mutated NSCLC.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Study of chemical properties and evaluation of collagen in mantle, epidermal connective tissue and tentacle of Indian Squid, Loligo duvauceli Orbigny

The chemical composition and evaluation of Indian squid (Loligo duvauceli) mantle, epidermal connective tissue and tentacle is investigated in this current study. It is observed that squid mantle contains 22.2% total protein; 63.5% of the total protein is myofibrillar protein. The unique property of squid myofibrillar protein is its water solubility. Squid mantle contains 12.0% total collagen. Epidermal connective tissue has highest amounts of total collagen (17.8%). SDS-PAGE of total collagen identified high molecular weight α-, β- and γ- sub-chains. Amino acid profile analysis indicates that mantle and tentacle contain essential amino acids. Arginine forms a major portion of mantle collagen (272.5 g/100 g N). Isoleucine, glutamic acid and lysine are other amino acids that are found in significantly high amounts in the mantle. Sulphur containing cystine is deficit in mantle collagen. Papain digest of mantle and epidermal connective tissue is rich in uronic acid, while papain digest, collagenase digest and urea digest of epidermal connective tissue has significant amounts of sialic acid (25.2, 33.2 and 99.8 μmol /100 g, respectively). PAS staining of papain digest, collagenase digest and urea digest also identify the association of hexoses with low molecular weight collagen fragments. Histochemical sectioning also emphasized the localized distribution of collagen in epidermal and dermal region and very sparse fibres traverse the myotome bundles

Epidermal growth factor-stimulated extravillous cytotrophoblast motility is mediated by the activation of PI3-K, Akt and both p38 and p42/44 mitogen-activated protein kinases

BACKGROUND: Trophoblast invasion is a temporally and spatially regulated scheme of events that can dictate pregnancy outcome. Evidence suggests that the potent mitogen epidermal growth factor (EGF) regulates cytotrophoblast (CTB) differentiation and invasion during early pregnancy. METHODS AND RESULTS: In the present study, the first trimester extravillous CTB cell line SGHPL-4 was used to investigate the signalling pathways involved in the motile component of EGF-mediated CTB migration/invasion. EGF induced the phosphorylation of the phosphatidylinositol 3-kinase (PI3-K)-dependent proteins, Akt and GSK-3β as well as both p42/44 MAPK and p38 mitogen-activated protein kinases (MAPK). EGF-stimulated motility was significantly reduced following the inhibition of PI3-K (P < 0.001), Akt (P < 0.01) and both p42/44 MAPK (P < 0.001) and p38 MAPKs (P < 0.001) but not the inhibition of GSK-3β. Further analysis indicated that the p38 MAPK inhibitor SB 203580 inhibited EGF-stimulated phosphorylation of Akt on serine 473, which may be responsible for the effect SB 203580 has on CTB motility. Although Akt activation leads to GSK-3β phosphorylation and the subsequent expression of β-catenin, activation of this pathway by 1-azakenpaullone was insufficient to stimulate the motile phenotype. CONCLUSION: We demonstrate a role for PI3-K, p42/44 MAPK and p38 MAPK in the stimulation of CTB cell motility by EGF, however activation of β-catenin alone was insufficient to stimulate cell motility.

Expression of AmphiCoe, an amphioxus COE/EBF gene, in the developing central nervous system and epidermal sensory neurons

The COE/EBF gene family marks a subset of prospective neurons in the vertebrate central and peripheral. nervous system; including neurons deriving from some ectodermal placodes. Since placodes are often considered unique to vertebrates, we have characterised an amphioxus COE/EBF gene with the aim of using it as a marker to examine the timing and location of peripheral neuron differentiation. A single COE/EBF family member, AmphiCoe, was isolated from the amphioxus Branchiostoma floridae: AmphiCoe lies basal to the vertebrate COE/EBF genes in molecular phylogenetic analysis, suggesting that the duplications that formed the vertebrate COE/EBF family were specific to the vertebrate lineage. AmphiCoe is expressed in the central nervous system and in a small number of scattered ectodermal cells on the flanks of neurulae stage embryos. These cells become at least largely recessed beneath the ectoderm. Scanning electron microscopy was used to examine embryos in which the ectoderm had been partially peeled away. This revealed that these cells have neuronal morphology, and we infer that they are the precursors of epidermal primary sensory neurons. These characters lead us to suggest that differentiation of some ectodermal cells into sensory neurons with a tendency to sink beneath the embryonic surface represents a primitive feature that has become incorporated into placodes during vertebrate evolution. (C) 2004 Wiley-Liss, Inc.

Inhibition of 125I-epidermal growth factor binding to murine fibroblasts and keratinocytes by irradiation with ultraviolet-B light

Treatment of murine Swiss 3T3 fibroblasts and XB/2 keratinocytes with UV-B light (302 nm) resulted in a dose-dependent inhibition of [125I] epidermal growth factor (EGF) binding. The light dose required to achieve 50% inhibition of binding in both cell types was 80–85 J/m2 Decreased [125I] platelet-derived growth factor binding was not evoked even by light doses of up to 280 J/m2 UV-B irradiation did not stimultate phosphorylation of the 80 kd protein substrate for protein kinase C. Furthermore, its effect on [125I]EGF binding was not altered as a consequence of protein kinase C down-regulation following prolonged exposure of cells to phorbol esters. These results indicate that UV-B-induced transmodulation of the epidermal growth factor receptor is a specific event mediated through a protein kinase C-indepen dent pathway. Transfer of culture medium from irradiated cells to untreated control cells showed this effect was not induced as a result of transforming growth factor α release and subsequent binding to the EGF receptor in these cells.

The Autoimmune Regulator (AIRE), Which Is Defective in Autoimmune Polyendocrinopathy-Candidiasis-Ectodermal Dystrophy Patients, Is Expressed in Human Epidermal and Follicular Keratinocytes and Associates With the Intermediate Filament Protein Cytokeratin 17

Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) syndrome, which is caused by mutation of the autoimmune regulator (AIRE) gene, is a highly variable disease characterized by multiple endocrine failure, chronic mucocutaneous candidiasis, and various ectodermal defects. AIRE is a transcriptional regulator classically expressed in medullary thymic epithelial cells, monocytes, macrophages, and dendritic cells. Previous studies have suggested that AIRE can shuttle between the nucleus and cytoplasm of cells, although its cytoplasmic functions are poorly characterized. Through mass spectrometry analysis of proteins co-immunoprecipitating with cytoplasmic AIRE, we identified a novel association of AIRE with the intermediate filament protein cytokeratin 17 (K17) in the THP-1 monocyte cell line. We confirmed AIRE expression in HaCaT epidermal keratinocytes, as well as its interaction with K17. Confocal microscopy of human fetal and adult scalp hair follicles demonstrated a cytoplasmic pattern of AIRE staining that moderately colocalized with K17. The cytoplasmic association of AIRE with the intermediate filament network in human epidermal and follicular keratinocytes may provide a new path to understanding the ectodermal abnormalities associated with the APECED syndrome. (Am J Pathol 2011, 178:983-988; DOI: 10.1016/j.ajpath.2010.12.007)